From e1ebb4eb5b44119d1408669533c154cd840ca828 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 21 Oct 2024 16:27:16 +0000
Subject: [PATCH 01/10] bug: filter conflicting keys when adding jb config

---
 .../apollo-shared/src/Changes/ImportJBrowseConfigChange.ts     | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/packages/apollo-shared/src/Changes/ImportJBrowseConfigChange.ts b/packages/apollo-shared/src/Changes/ImportJBrowseConfigChange.ts
index c8eec77e2..3e60d28af 100644
--- a/packages/apollo-shared/src/Changes/ImportJBrowseConfigChange.ts
+++ b/packages/apollo-shared/src/Changes/ImportJBrowseConfigChange.ts
@@ -39,7 +39,8 @@ export interface SerializedImportJBrowseConfigChange {
 }
 
 export function filterJBrowseConfig(config: JBrowseConfig): JBrowseConfig {
-  const { assemblies, internetAccounts, plugins, tracks, ...rest } = config
+  const { __v, _id, assemblies, internetAccounts, plugins, tracks, ...rest } =
+    config
   const filteredAssemblies = assemblies?.filter(
     (a) => a.sequence.adapter.type !== 'ApolloSequenceAdapter',
   )

From e1215f642c1af973925bc1cd50b6fd4c2032fe17 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 21 Oct 2024 16:56:22 +0000
Subject: [PATCH 02/10] Make input files args not flags in CLI

---
 .github/workflows/reload_demo_data.yml        |  4 +-
 packages/apollo-cli/README.md                 | 38 +++++++++++--------
 .../src/commands/assembly/add-from-fasta.ts   |  5 +--
 .../src/commands/assembly/add-from-gff.ts     |  6 +--
 packages/apollo-cli/src/commands/config.ts    |  3 +-
 .../apollo-cli/src/commands/feature/import.ts | 20 +++++-----
 .../apollo-cli/src/commands/file/upload.ts    | 26 +++++++------
 .../src/commands/refseq/add-alias.ts          | 20 +++++-----
 packages/website/docs/cli/assembly.md         |  2 +-
 packages/website/docs/cli/feature.md          | 12 +++---
 packages/website/docs/cli/file.md             | 12 +++---
 packages/website/docs/cli/refseq.md           | 12 +++---
 12 files changed, 87 insertions(+), 73 deletions(-)

diff --git a/.github/workflows/reload_demo_data.yml b/.github/workflows/reload_demo_data.yml
index f5fa4a1e6..807d047d2 100644
--- a/.github/workflows/reload_demo_data.yml
+++ b/.github/workflows/reload_demo_data.yml
@@ -102,10 +102,10 @@ jobs:
 
           apollo feature \
             import \
-            --input-file /data/schistosoma_haematobium.TD2_PRJEB44434.WBPS19.annotations.genes.gff3 \
+            /data/schistosoma_haematobium.TD2_PRJEB44434.WBPS19.annotations.genes.gff3 \
             --assembly 'Schistosoma haematobium'
 
           apollo feature \
             import \
-            --input-file /data/schistosoma_mansoni.PRJEA36577.WBPS19.annotations.genes.gff3 \
+            /data/schistosoma_mansoni.PRJEA36577.WBPS19.annotations.genes.gff3 \
             --assembly 'Schistosoma mansoni'
diff --git a/packages/apollo-cli/README.md b/packages/apollo-cli/README.md
index 74bd15ece..a413133e0 100644
--- a/packages/apollo-cli/README.md
+++ b/packages/apollo-cli/README.md
@@ -47,18 +47,18 @@ USAGE
 - [`apollo feature edit-type`](#apollo-feature-edit-type)
 - [`apollo feature get`](#apollo-feature-get)
 - [`apollo feature get-id`](#apollo-feature-get-id)
-- [`apollo feature import`](#apollo-feature-import)
+- [`apollo feature import INPUT-FILE`](#apollo-feature-import-input-file)
 - [`apollo feature search`](#apollo-feature-search)
 - [`apollo file delete`](#apollo-file-delete)
 - [`apollo file download`](#apollo-file-download)
 - [`apollo file get`](#apollo-file-get)
-- [`apollo file upload`](#apollo-file-upload)
+- [`apollo file upload INPUT-FILE`](#apollo-file-upload-input-file)
 - [`apollo help [COMMANDS]`](#apollo-help-commands)
 - [`apollo jbrowse get-config`](#apollo-jbrowse-get-config)
 - [`apollo jbrowse set-config INPUTFILE`](#apollo-jbrowse-set-config-inputfile)
 - [`apollo login`](#apollo-login)
 - [`apollo logout`](#apollo-logout)
-- [`apollo refseq add-alias`](#apollo-refseq-add-alias)
+- [`apollo refseq add-alias INPUT-FILE`](#apollo-refseq-add-alias-input-file)
 - [`apollo refseq get`](#apollo-refseq-get)
 - [`apollo status`](#apollo-status)
 - [`apollo user get`](#apollo-user-get)
@@ -137,7 +137,7 @@ DESCRIPTION
 EXAMPLES
   Import sequences and features:
 
-    $ apollo assembly add-from-gff -i genome.gff -a myAssembly
+    $ apollo assembly add-from-gff genome.gff -a myAssembly
 
   Import sequences only:
 
@@ -674,18 +674,20 @@ EXAMPLES
 _See code:
 [src/commands/feature/get-id.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/get-id.ts)_
 
-## `apollo feature import`
+## `apollo feature import INPUT-FILE`
 
 Import features from local gff file
 
 ```
 USAGE
-  $ apollo feature import -i <value> -a <value> [--profile <value>] [--config-file <value>] [-d]
+  $ apollo feature import INPUT-FILE -a <value> [--profile <value>] [--config-file <value>] [-d]
+
+ARGUMENTS
+  INPUT-FILE  Input gff file
 
 FLAGS
   -a, --assembly=<value>     (required) Import into this assembly name or assembly ID
   -d, --delete-existing      Delete existing features before importing
-  -i, --input-file=<value>   (required) Input gff file
       --config-file=<value>  Use this config file (mostly for testing)
       --profile=<value>      Use credentials from this profile
 
@@ -697,7 +699,7 @@ DESCRIPTION
 EXAMPLES
   Delete features in myAssembly and then import features.gff3:
 
-    $ apollo feature import -d -i features.gff3 -a myAssembly
+    $ apollo feature import features.gff3 -d -a myAssembly
 ```
 
 _See code:
@@ -836,18 +838,20 @@ EXAMPLES
 _See code:
 [src/commands/file/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/get.ts)_
 
-## `apollo file upload`
+## `apollo file upload INPUT-FILE`
 
 Upload a local file to the Apollo server
 
 ```
 USAGE
-  $ apollo file upload -i <value> [--profile <value>] [--config-file <value>] [-t
+  $ apollo file upload INPUT-FILE [--profile <value>] [--config-file <value>] [-t
     text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi] [-z | -d]
 
+ARGUMENTS
+  INPUT-FILE  Local file to upload
+
 FLAGS
   -d, --decompressed         Override autodetection and instruct that input is decompressed
-  -i, --input-file=<value>   (required) Local file to upload
   -t, --type=<option>        Set file type or autodetected it if not set.
                              NB: There is no check for whether the file complies to this type
                              <options: text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi>
@@ -865,7 +869,7 @@ DESCRIPTION
 EXAMPLES
   Upload local file, type auto-detected:
 
-    $ apollo file upload -i genome.fa > file.json
+    $ apollo file upload genome.fa > file.json
 ```
 
 _See code:
@@ -1016,17 +1020,19 @@ EXAMPLES
 _See code:
 [src/commands/logout.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/logout.ts)_
 
-## `apollo refseq add-alias`
+## `apollo refseq add-alias INPUT-FILE`
 
 Add reference name aliases from a file
 
 ```
 USAGE
-  $ apollo refseq add-alias -i <value> -a <value> [--profile <value>] [--config-file <value>]
+  $ apollo refseq add-alias INPUT-FILE -a <value> [--profile <value>] [--config-file <value>]
+
+ARGUMENTS
+  INPUT-FILE  Input refname alias file
 
 FLAGS
   -a, --assembly=<value>     (required) Name for this assembly.
-  -i, --input-file=<value>   (required) Input refname alias file
       --config-file=<value>  Use this config file (mostly for testing)
       --profile=<value>      Use credentials from this profile
 
@@ -1039,7 +1045,7 @@ DESCRIPTION
 EXAMPLES
   Add reference name aliases:
 
-    $ apollo refseq add-alias -i alias.txt -a myAssembly
+    $ apollo refseq add-alias alias.txt -a myAssembly
 ```
 
 _See code:
diff --git a/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts b/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts
index eb2f3e79e..fee9d4890 100644
--- a/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts
+++ b/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts
@@ -11,7 +11,7 @@ import { Response } from 'undici'
 export default class AddFasta extends FileCommand {
   static summary = 'Add a new assembly from fasta input'
   static description = `Add new assembly. The input fasta may be:
-    * A local file 
+    * A local file
     * An external fasta file
     * The id of a file previously uploaded to Apollo`
 
@@ -77,8 +77,7 @@ Indexes should be named <my.fasta.gz>.gzi and <my.fasta.gz>.fai unless options -
   }
 
   public async run(): Promise<void> {
-    const { args } = await this.parse(AddFasta)
-    const { flags } = await this.parse(AddFasta)
+    const { args, flags } = await this.parse(AddFasta)
 
     const access = await this.getAccess()
 
diff --git a/packages/apollo-cli/src/commands/assembly/add-from-gff.ts b/packages/apollo-cli/src/commands/assembly/add-from-gff.ts
index 04562a0f1..acbb07137 100644
--- a/packages/apollo-cli/src/commands/assembly/add-from-gff.ts
+++ b/packages/apollo-cli/src/commands/assembly/add-from-gff.ts
@@ -15,8 +15,7 @@ export default class AddGff extends FileCommand {
   static examples = [
     {
       description: 'Import sequences and features:',
-      command:
-        '<%= config.bin %> <%= command.id %> -i genome.gff -a myAssembly',
+      command: '<%= config.bin %> <%= command.id %> genome.gff -a myAssembly',
     },
     {
       description: 'Import sequences only:',
@@ -48,8 +47,7 @@ export default class AddGff extends FileCommand {
   }
 
   public async run(): Promise<void> {
-    const { args } = await this.parse(AddGff)
-    const { flags } = await this.parse(AddGff)
+    const { args, flags } = await this.parse(AddGff)
 
     if (!fs.existsSync(args['input-file'])) {
       this.error(`File ${args['input-file']} does not exist`)
diff --git a/packages/apollo-cli/src/commands/config.ts b/packages/apollo-cli/src/commands/config.ts
index 558917dc6..d3433f37d 100644
--- a/packages/apollo-cli/src/commands/config.ts
+++ b/packages/apollo-cli/src/commands/config.ts
@@ -56,8 +56,7 @@ export default class ApolloConfig extends BaseCommand<typeof ApolloConfig> {
   ]
 
   public async run(): Promise<void> {
-    const { args } = await this.parse(ApolloConfig)
-    const { flags } = await this.parse(ApolloConfig)
+    const { args, flags } = await this.parse(ApolloConfig)
 
     let configFile = flags['config-file']
     configFile =
diff --git a/packages/apollo-cli/src/commands/feature/import.ts b/packages/apollo-cli/src/commands/feature/import.ts
index b31de4998..31b9ccb22 100644
--- a/packages/apollo-cli/src/commands/feature/import.ts
+++ b/packages/apollo-cli/src/commands/feature/import.ts
@@ -1,7 +1,7 @@
 import * as fs from 'node:fs'
 
 import { type SerializedAddFeaturesFromFileChange } from '@apollo-annotation/shared'
-import { Flags } from '@oclif/core'
+import { Args, Flags } from '@oclif/core'
 import { Agent, RequestInit, fetch } from 'undici'
 
 import { FileCommand } from '../../fileCommand.js'
@@ -20,16 +20,18 @@ export default class Import extends FileCommand {
       description:
         'Delete features in myAssembly and then import features.gff3:',
       command:
-        '<%= config.bin %> <%= command.id %> -d -i features.gff3 -a myAssembly',
+        '<%= config.bin %> <%= command.id %> features.gff3 -d -a myAssembly',
     },
   ]
 
-  static flags = {
-    'input-file': Flags.string({
-      char: 'i',
+  static args = {
+    'input-file': Args.string({
       description: 'Input gff file',
       required: true,
     }),
+  }
+
+  static flags = {
     assembly: Flags.string({
       char: 'a',
       description: 'Import into this assembly name or assembly ID',
@@ -42,10 +44,10 @@ export default class Import extends FileCommand {
   }
 
   public async run(): Promise<void> {
-    const { flags } = await this.parse(Import)
+    const { args, flags } = await this.parse(Import)
 
-    if (!fs.existsSync(flags['input-file'])) {
-      this.error(`File "${flags['input-file']}" does not exist`)
+    if (!fs.existsSync(args['input-file'])) {
+      this.error(`File "${args['input-file']}" does not exist`)
     }
 
     const access = await this.getAccess()
@@ -64,7 +66,7 @@ export default class Import extends FileCommand {
     const uploadId = await this.uploadFile(
       access.address,
       access.accessToken,
-      flags['input-file'],
+      args['input-file'],
       'text/x-gff3',
       false,
     )
diff --git a/packages/apollo-cli/src/commands/file/upload.ts b/packages/apollo-cli/src/commands/file/upload.ts
index bb2d0b2e6..97076bf8f 100644
--- a/packages/apollo-cli/src/commands/file/upload.ts
+++ b/packages/apollo-cli/src/commands/file/upload.ts
@@ -1,4 +1,4 @@
-import { Flags } from '@oclif/core'
+import { Args, Flags } from '@oclif/core'
 import { Response } from 'undici'
 
 import { FileCommand } from '../../fileCommand.js'
@@ -12,16 +12,18 @@ export default class Upload extends FileCommand {
   static examples = [
     {
       description: 'Upload local file, type auto-detected:',
-      command: '<%= config.bin %> <%= command.id %> -i genome.fa > file.json',
+      command: '<%= config.bin %> <%= command.id %> genome.fa > file.json',
     },
   ]
 
-  static flags = {
-    'input-file': Flags.string({
-      char: 'i',
+  static args = {
+    'input-file': Args.string({
       description: 'Local file to upload',
       required: true,
     }),
+  }
+
+  static flags = {
     type: Flags.string({
       char: 't',
       description:
@@ -50,18 +52,18 @@ export default class Upload extends FileCommand {
   }
 
   public async run(): Promise<void> {
-    const { flags } = await this.parse(Upload)
+    const { args, flags } = await this.parse(Upload)
 
     const access = await this.getAccess()
 
     let { type } = flags
     if (type === undefined) {
-      const hasGzipExt = flags['input-file'].endsWith('.gz')
-      const infile = flags['input-file'].replace(/\.gz$/, '')
+      const hasGzipExt = args['input-file'].endsWith('.gz')
+      const infile = args['input-file'].replace(/\.gz$/, '')
 
       if (/\.fasta$|\.fas$|\.fa$|\.fna$/.test(infile) && hasGzipExt) {
         this.error(
-          `Unable to auto-detect file type for "${flags['input-file']}" since it may be gzip or bgzip compressed. Please set the -t/--type option`,
+          `Unable to auto-detect file type for "${args['input-file']}" since it may be gzip or bgzip compressed. Please set the -t/--type option`,
         )
       } else if (/\.fasta$|\.fas$|\.fa$|\.fna$/.test(infile)) {
         type = 'text/x-fasta'
@@ -73,12 +75,12 @@ export default class Upload extends FileCommand {
         type = 'application/x-gzi'
       } else {
         this.error(
-          `Unable to auto-detect the type of file "${flags['input-file']}". Please set the --type/-t option.`,
+          `Unable to auto-detect the type of file "${args['input-file']}". Please set the --type/-t option.`,
         )
       }
     }
 
-    let isGzip = flags['input-file'].endsWith('.gz')
+    let isGzip = args['input-file'].endsWith('.gz')
     // eslint-disable-next-line unicorn/consistent-destructuring
     if (flags.gzip) {
       isGzip = true
@@ -93,7 +95,7 @@ export default class Upload extends FileCommand {
     const fileId = await this.uploadFile(
       access.address,
       access.accessToken,
-      flags['input-file'],
+      args['input-file'],
       type,
 
       isGzip,
diff --git a/packages/apollo-cli/src/commands/refseq/add-alias.ts b/packages/apollo-cli/src/commands/refseq/add-alias.ts
index 47dde5661..845980775 100644
--- a/packages/apollo-cli/src/commands/refseq/add-alias.ts
+++ b/packages/apollo-cli/src/commands/refseq/add-alias.ts
@@ -1,6 +1,6 @@
 import * as fs from 'node:fs'
 import { Agent, RequestInit, Response, fetch } from 'undici'
-import { Flags } from '@oclif/core'
+import { Args, Flags } from '@oclif/core'
 import { BaseCommand } from '../../baseCommand.js'
 import {
   createFetchErrorMessage,
@@ -21,16 +21,18 @@ export default class AddRefNameAlias extends BaseCommand<
   static examples = [
     {
       description: 'Add reference name aliases:',
-      command: '<%= config.bin %> <%= command.id %> -i alias.txt -a myAssembly',
+      command: '<%= config.bin %> <%= command.id %> alias.txt -a myAssembly',
     },
   ]
 
-  static flags = {
-    'input-file': Flags.string({
-      char: 'i',
+  static args = {
+    'input-file': Args.string({
       description: 'Input refname alias file',
       required: true,
     }),
+  }
+
+  static flags = {
     assembly: Flags.string({
       char: 'a',
       description: 'Name for this assembly.',
@@ -39,14 +41,14 @@ export default class AddRefNameAlias extends BaseCommand<
   }
 
   async run(): Promise<void> {
-    const { flags } = await this.parse(AddRefNameAlias)
+    const { args, flags } = await this.parse(AddRefNameAlias)
 
-    if (!fs.existsSync(flags['input-file'])) {
-      this.error(`File ${flags['input-file']} does not exist`)
+    if (!fs.existsSync(args['input-file'])) {
+      this.error(`File ${args['input-file']} does not exist`)
     }
 
     const access = await this.getAccess()
-    const filehandle = await fs.promises.open(flags['input-file'])
+    const filehandle = await fs.promises.open(args['input-file'])
     const fileContent = await filehandle.readFile({ encoding: 'utf8' })
     await filehandle.close()
     const lines = fileContent.split('\n')
diff --git a/packages/website/docs/cli/assembly.md b/packages/website/docs/cli/assembly.md
index 830eb5e00..ad29d11ad 100644
--- a/packages/website/docs/cli/assembly.md
+++ b/packages/website/docs/cli/assembly.md
@@ -83,7 +83,7 @@ DESCRIPTION
 EXAMPLES
   Import sequences and features:
 
-    $ apollo assembly add-from-gff -i genome.gff -a myAssembly
+    $ apollo assembly add-from-gff genome.gff -a myAssembly
 
   Import sequences only:
 
diff --git a/packages/website/docs/cli/feature.md b/packages/website/docs/cli/feature.md
index 00d9ca7bd..8722363cd 100644
--- a/packages/website/docs/cli/feature.md
+++ b/packages/website/docs/cli/feature.md
@@ -12,7 +12,7 @@ Commands to manage features
 - [`apollo feature edit-type`](#apollo-feature-edit-type)
 - [`apollo feature get`](#apollo-feature-get)
 - [`apollo feature get-id`](#apollo-feature-get-id)
-- [`apollo feature import`](#apollo-feature-import)
+- [`apollo feature import INPUT-FILE`](#apollo-feature-import-input-file)
 - [`apollo feature search`](#apollo-feature-search)
 
 ## `apollo feature add-child`
@@ -336,18 +336,20 @@ EXAMPLES
 _See code:
 [src/commands/feature/get-id.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/get-id.ts)_
 
-## `apollo feature import`
+## `apollo feature import INPUT-FILE`
 
 Import features from local gff file
 
 ```
 USAGE
-  $ apollo feature import -i <value> -a <value> [--profile <value>] [--config-file <value>] [-d]
+  $ apollo feature import INPUT-FILE -a <value> [--profile <value>] [--config-file <value>] [-d]
+
+ARGUMENTS
+  INPUT-FILE  Input gff file
 
 FLAGS
   -a, --assembly=<value>     (required) Import into this assembly name or assembly ID
   -d, --delete-existing      Delete existing features before importing
-  -i, --input-file=<value>   (required) Input gff file
       --config-file=<value>  Use this config file (mostly for testing)
       --profile=<value>      Use credentials from this profile
 
@@ -359,7 +361,7 @@ DESCRIPTION
 EXAMPLES
   Delete features in myAssembly and then import features.gff3:
 
-    $ apollo feature import -d -i features.gff3 -a myAssembly
+    $ apollo feature import features.gff3 -d -a myAssembly
 ```
 
 _See code:
diff --git a/packages/website/docs/cli/file.md b/packages/website/docs/cli/file.md
index eb8972a6e..fce497972 100644
--- a/packages/website/docs/cli/file.md
+++ b/packages/website/docs/cli/file.md
@@ -5,7 +5,7 @@ Commands to manage files
 - [`apollo file delete`](#apollo-file-delete)
 - [`apollo file download`](#apollo-file-download)
 - [`apollo file get`](#apollo-file-get)
-- [`apollo file upload`](#apollo-file-upload)
+- [`apollo file upload INPUT-FILE`](#apollo-file-upload-input-file)
 
 ## `apollo file delete`
 
@@ -89,18 +89,20 @@ EXAMPLES
 _See code:
 [src/commands/file/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/get.ts)_
 
-## `apollo file upload`
+## `apollo file upload INPUT-FILE`
 
 Upload a local file to the Apollo server
 
 ```
 USAGE
-  $ apollo file upload -i <value> [--profile <value>] [--config-file <value>] [-t
+  $ apollo file upload INPUT-FILE [--profile <value>] [--config-file <value>] [-t
     text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi] [-z | -d]
 
+ARGUMENTS
+  INPUT-FILE  Local file to upload
+
 FLAGS
   -d, --decompressed         Override autodetection and instruct that input is decompressed
-  -i, --input-file=<value>   (required) Local file to upload
   -t, --type=<option>        Set file type or autodetected it if not set.
                              NB: There is no check for whether the file complies to this type
                              <options: text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi>
@@ -118,7 +120,7 @@ DESCRIPTION
 EXAMPLES
   Upload local file, type auto-detected:
 
-    $ apollo file upload -i genome.fa > file.json
+    $ apollo file upload genome.fa > file.json
 ```
 
 _See code:
diff --git a/packages/website/docs/cli/refseq.md b/packages/website/docs/cli/refseq.md
index c3a291492..16c7ef5ae 100644
--- a/packages/website/docs/cli/refseq.md
+++ b/packages/website/docs/cli/refseq.md
@@ -2,20 +2,22 @@
 
 Commands to manage reference sequences
 
-- [`apollo refseq add-alias`](#apollo-refseq-add-alias)
+- [`apollo refseq add-alias INPUT-FILE`](#apollo-refseq-add-alias-input-file)
 - [`apollo refseq get`](#apollo-refseq-get)
 
-## `apollo refseq add-alias`
+## `apollo refseq add-alias INPUT-FILE`
 
 Add reference name aliases from a file
 
 ```
 USAGE
-  $ apollo refseq add-alias -i <value> -a <value> [--profile <value>] [--config-file <value>]
+  $ apollo refseq add-alias INPUT-FILE -a <value> [--profile <value>] [--config-file <value>]
+
+ARGUMENTS
+  INPUT-FILE  Input refname alias file
 
 FLAGS
   -a, --assembly=<value>     (required) Name for this assembly.
-  -i, --input-file=<value>   (required) Input refname alias file
       --config-file=<value>  Use this config file (mostly for testing)
       --profile=<value>      Use credentials from this profile
 
@@ -28,7 +30,7 @@ DESCRIPTION
 EXAMPLES
   Add reference name aliases:
 
-    $ apollo refseq add-alias -i alias.txt -a myAssembly
+    $ apollo refseq add-alias alias.txt -a myAssembly
 ```
 
 _See code:

From 3bd302b220f9a522ed449f846ccc1de94bf48d79 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 21 Oct 2024 17:45:32 +0000
Subject: [PATCH 03/10] Make "not-editable" the default when adding fasta

---
 packages/apollo-cli/README.md                 | 1089 -----------------
 .../src/commands/assembly/add-from-fasta.ts   |  105 +-
 packages/apollo-cli/src/utils.ts              |   68 +-
 3 files changed, 83 insertions(+), 1179 deletions(-)

diff --git a/packages/apollo-cli/README.md b/packages/apollo-cli/README.md
index a413133e0..bd1ca6fc6 100644
--- a/packages/apollo-cli/README.md
+++ b/packages/apollo-cli/README.md
@@ -29,851 +29,7 @@ USAGE
 
 <!-- commands -->
 
-- [`apollo assembly add-from-fasta INPUT`](#apollo-assembly-add-from-fasta-input)
-- [`apollo assembly add-from-gff INPUT-FILE`](#apollo-assembly-add-from-gff-input-file)
-- [`apollo assembly check`](#apollo-assembly-check)
-- [`apollo assembly delete`](#apollo-assembly-delete)
-- [`apollo assembly get`](#apollo-assembly-get)
-- [`apollo assembly sequence`](#apollo-assembly-sequence)
-- [`apollo change get`](#apollo-change-get)
-- [`apollo config [KEY] [VALUE]`](#apollo-config-key-value)
-- [`apollo feature add-child`](#apollo-feature-add-child)
-- [`apollo feature check`](#apollo-feature-check)
-- [`apollo feature copy`](#apollo-feature-copy)
-- [`apollo feature delete`](#apollo-feature-delete)
-- [`apollo feature edit`](#apollo-feature-edit)
-- [`apollo feature edit-attribute`](#apollo-feature-edit-attribute)
-- [`apollo feature edit-coords`](#apollo-feature-edit-coords)
-- [`apollo feature edit-type`](#apollo-feature-edit-type)
-- [`apollo feature get`](#apollo-feature-get)
-- [`apollo feature get-id`](#apollo-feature-get-id)
-- [`apollo feature import INPUT-FILE`](#apollo-feature-import-input-file)
-- [`apollo feature search`](#apollo-feature-search)
-- [`apollo file delete`](#apollo-file-delete)
-- [`apollo file download`](#apollo-file-download)
-- [`apollo file get`](#apollo-file-get)
-- [`apollo file upload INPUT-FILE`](#apollo-file-upload-input-file)
 - [`apollo help [COMMANDS]`](#apollo-help-commands)
-- [`apollo jbrowse get-config`](#apollo-jbrowse-get-config)
-- [`apollo jbrowse set-config INPUTFILE`](#apollo-jbrowse-set-config-inputfile)
-- [`apollo login`](#apollo-login)
-- [`apollo logout`](#apollo-logout)
-- [`apollo refseq add-alias INPUT-FILE`](#apollo-refseq-add-alias-input-file)
-- [`apollo refseq get`](#apollo-refseq-get)
-- [`apollo status`](#apollo-status)
-- [`apollo user get`](#apollo-user-get)
-
-## `apollo assembly add-from-fasta INPUT`
-
-Add a new assembly from fasta input
-
-```
-USAGE
-  $ apollo assembly add-from-fasta INPUT [--profile <value>] [--config-file <value>] [-a <value>] [-x <value>] [-f] [-n]
-    [--fai <value>] [--gzi <value>] [-z | -d]
-
-ARGUMENTS
-  INPUT  Input fasta file, local or remote, or id of a previously uploaded file
-
-FLAGS
-  -a, --assembly=<value>     Name for this assembly. Use the file name if omitted
-  -d, --decompressed         For local file input: Override autodetection and instruct that input is decompressed
-  -f, --force                Delete existing assembly, if it exists
-  -n, --not-editable         The fasta sequence is not editable. Apollo will not load it into the database and instead
-                             use the provided indexes to query it. This option assumes the fasta file is bgzip'd with
-                             `bgzip` and indexed with `samtools faidx`. Indexes should be named <my.fasta.gz>.gzi and
-                             <my.fasta.gz>.fai unless options --fai and --gzi are set
-  -x, --index=<value>        URL of the index. Required if input is an external source
-  -z, --gzip                 For local file input: Override autodetection and instruct that input is gzip compressed
-      --config-file=<value>  Use this config file (mostly for testing)
-      --fai=<value>          Fasta index of the (not-editable) fasta file
-      --gzi=<value>          Gzi index of the (not-editable) fasta file
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Add a new assembly from fasta input
-
-  Add new assembly. The input fasta may be:
-  * A local file
-  * An external fasta file
-  * The id of a file previously uploaded to Apollo
-
-EXAMPLES
-  From local file:
-
-    $ apollo assembly add-from-fasta genome.fa -a myAssembly
-
-  From external source we also need the URL of the index:
-
-    $ apollo assembly add-from-fasta https://.../genome.fa -x https://.../genome.fa.fai -a myAssembly
-```
-
-_See code:
-[src/commands/assembly/add-from-fasta.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts)_
-
-## `apollo assembly add-from-gff INPUT-FILE`
-
-Add new assembly from gff or gft file
-
-```
-USAGE
-  $ apollo assembly add-from-gff INPUT-FILE [--profile <value>] [--config-file <value>] [-a <value>] [-o] [-f]
-
-ARGUMENTS
-  INPUT-FILE  Input gff file
-
-FLAGS
-  -a, --assembly=<value>     Name for this assembly. Use the file name if omitted
-  -f, --force                Delete existing assembly, if it exists
-  -o, --omit-features        Do not import features, only upload the sequences
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Add new assembly from gff or gft file
-
-  The gff file is expected to contain sequences as per gff specifications. Features are also imported by default.
-
-EXAMPLES
-  Import sequences and features:
-
-    $ apollo assembly add-from-gff genome.gff -a myAssembly
-
-  Import sequences only:
-
-    $ apollo assembly add-from-gff genome.gff -a myAssembly -o
-```
-
-_See code:
-[src/commands/assembly/add-from-gff.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/add-from-gff.ts)_
-
-## `apollo assembly check`
-
-Add, view, or delete checks to assembly
-
-```
-USAGE
-  $ apollo assembly check [--profile <value>] [--config-file <value>] [-a <value>] [-c <value>] [-d]
-
-FLAGS
-  -a, --assembly=<value>     Manage checks in this assembly
-  -c, --check=<value>...     Add these check names or IDs. If unset, print the checks set for assembly
-  -d, --delete               Delete (instead of adding) checks
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Add, view, or delete checks to assembly
-
-  Manage checks, i.e. the rules ensuring features in an assembly are plausible. This command only sets the checks to
-  apply, to retrieve features flagged by these checks use `apollo feature check`.
-
-EXAMPLES
-  View available check types:
-
-    $ apollo assembly check
-
-  View checks set for assembly hg19:
-
-    $ apollo assembly check -a hg19
-
-  Add checks to assembly:
-
-    $ apollo assembly check -a hg19 -c CDSCheck
-
-  Delete checks from assembly:
-
-    $ apollo assembly check -a hg19 -c CDSCheck --delete
-```
-
-_See code:
-[src/commands/assembly/check.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/check.ts)_
-
-## `apollo assembly delete`
-
-Delete assemblies
-
-```
-USAGE
-  $ apollo assembly delete -a <value> [--profile <value>] [--config-file <value>] [-v]
-
-FLAGS
-  -a, --assembly=<value>...  (required) Assembly names or IDs to delete
-  -v, --verbose              Print to stdout the array of assemblies deleted
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Delete assemblies
-
-  Assemblies to delete may be names or IDs
-
-EXAMPLES
-  Delete multiple assemblies using name or ID:
-
-    $ apollo assembly delete -a mouse 6605826fbd0eee691f83e73f
-```
-
-_See code:
-[src/commands/assembly/delete.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/delete.ts)_
-
-## `apollo assembly get`
-
-Get available assemblies
-
-```
-USAGE
-  $ apollo assembly get [--profile <value>] [--config-file <value>] [-a <value>]
-
-FLAGS
-  -a, --assembly=<value>...  Get assemblies in this list of names or IDs
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Get available assemblies
-
-  Print to stdout the list of assemblies in json format
-```
-
-_See code:
-[src/commands/assembly/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/get.ts)_
-
-## `apollo assembly sequence`
-
-Get reference sequence in fasta format
-
-```
-USAGE
-  $ apollo assembly sequence [--profile <value>] [--config-file <value>] [-a <value>] [-r <value>] [-s <value>] [-e
-    <value>]
-
-FLAGS
-  -a, --assembly=<value>     Find input reference sequence in this assembly
-  -e, --end=<value>          End coordinate
-  -r, --refseq=<value>       Reference sequence. If unset, get all sequences
-  -s, --start=<value>        [default: 1] Start coordinate (1-based)
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Get reference sequence in fasta format
-
-  Return the reference sequence for a given assembly and coordinates
-
-EXAMPLES
-  Get all sequences in myAssembly:
-
-    $ apollo assembly sequence -a myAssembly
-
-  Get sequence in coordinates chr1:1..1000:
-
-    $ apollo assembly sequence -a myAssembly -r chr1 -s 1 -e 1000
-```
-
-_See code:
-[src/commands/assembly/sequence.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/sequence.ts)_
-
-## `apollo change get`
-
-Get list of changes
-
-```
-USAGE
-  $ apollo change get [--profile <value>] [--config-file <value>] [-a <value>]
-
-FLAGS
-  -a, --assembly=<value>...  Get changes only for these assembly names or IDs (but see description)
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Get list of changes
-
-  Return the change log in json format. Note that when an assembly is deleted the link between common name and ID is
-  lost (it can still be recovered by inspecting the change log but at present this task is left to the user). In such
-  cases you need to use the assembly ID.
-```
-
-_See code:
-[src/commands/change/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/change/get.ts)_
-
-## `apollo config [KEY] [VALUE]`
-
-Get or set apollo configuration options
-
-```
-USAGE
-  $ apollo config [KEY] [VALUE] [--profile <value>] [---file <value>] [--get-config-file]
-
-ARGUMENTS
-  KEY    Name of configuration parameter
-  VALUE  Parameter value
-
-FLAGS
-  --config-file=<value>  Use this config file (mostly for testing)
-  --get-config-file      Return the path to the config file and exit (this file may not exist yet)
-  --profile=<value>      Profile to create or edit
-
-DESCRIPTION
-  Get or set apollo configuration options
-
-  Use this command to create or edit a user profile with credentials to access Apollo. Configuration options are:
-
-  - address:
-  Address and port e.g http://localhost:3999
-
-  - accessType:
-  How to access Apollo. accessType is typically one of: google, microsoft, guest, root. Allowed types depend on your
-  Apollo setup
-
-  - accessToken:
-  Access token. Usually inserted by `apollo login`
-
-  - rootCredentials.username:
-  Username of root account. Only set this for "root" access type
-
-  - rootCredentials.password:
-  Password for root account. Only set this for "root" access type
-
-EXAMPLES
-  Interactive setup:
-
-    $ apollo config
-
-  Setup with key/value pairs:
-
-    $ apollo config --profile admin address http://localhost:3999
-
-  Get current address for default profile:
-
-    $ apollo config address
-```
-
-_See code:
-[src/commands/config.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/config.ts)_
-
-## `apollo feature add-child`
-
-Add a child feature (e.g. add an exon to an mRNA)
-
-```
-USAGE
-  $ apollo feature add-child -s <value> -e <value> -t <value> [--profile <value>] [--config-file <value>] [-i <value>]
-
-FLAGS
-  -e, --end=<value>          (required) End coordinate of the child feature (1-based)
-  -i, --feature-id=<value>   [default: -] Add a child to this feature ID; use - to read it from stdin
-  -s, --start=<value>        (required) Start coordinate of the child feature (1-based)
-  -t, --type=<value>         (required) Type of child feature
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Add a child feature (e.g. add an exon to an mRNA)
-
-  See the other commands under `apollo feature` to retrive the parent ID of interest and to populate the child feature
-  with attributes.
-
-EXAMPLES
-  Add an exon at genomic coordinates 10..20 to this feature ID:
-
-    $ apollo feature add-child -i 660...73f -t exon -s 10 -e 20
-```
-
-_See code:
-[src/commands/feature/add-child.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/add-child.ts)_
-
-## `apollo feature check`
-
-Get check results
-
-```
-USAGE
-  $ apollo feature check [--profile <value>] [--config-file <value>] [-i <value>] [-a <value>]
-
-FLAGS
-  -a, --assembly=<value>       Get checks for this assembly
-  -i, --feature-id=<value>...  Get checks for these feature identifiers
-      --config-file=<value>    Use this config file (mostly for testing)
-      --profile=<value>        Use credentials from this profile
-
-DESCRIPTION
-  Get check results
-
-  Use this command to view which features fail checks along with the reason for failing.Use `apollo assembly check` for
-  managing which checks should be applied to an assembly
-
-EXAMPLES
-  Get all check results in the database:
-
-    $ apollo feature check
-
-  Get check results for assembly hg19:
-
-    $ apollo feature check -a hg19
-```
-
-_See code:
-[src/commands/feature/check.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/check.ts)_
-
-## `apollo feature copy`
-
-Copy a feature to another location
-
-```
-USAGE
-  $ apollo feature copy -r <value> -s <value> [--profile <value>] [--config-file <value>] [-i <value>] [-a <value>]
-
-FLAGS
-  -a, --assembly=<value>     Name or ID of target assembly. Not required if refseq is unique in the database
-  -i, --feature-id=<value>   [default: -] Feature ID to copy to; use - to read it from stdin
-  -r, --refseq=<value>       (required) Name or ID of target reference sequence
-  -s, --start=<value>        (required) Start position in target reference sequence
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Copy a feature to another location
-
-  The feature may be copied to the same or to a different assembly. The destination reference sequence may be selected
-  by name only if unique in the database or by name and assembly or by identifier.
-
-EXAMPLES
-  Copy this feature ID to chr1:100 in assembly hg38:
-
-    $ apollo feature copy -i 6605826fbd0eee691f83e73f -r chr1 -s 100 -a hg38
-```
-
-_See code:
-[src/commands/feature/copy.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/copy.ts)_
-
-## `apollo feature delete`
-
-Delete one or more features by ID
-
-```
-USAGE
-  $ apollo feature delete [--profile <value>] [--config-file <value>] [-i <value>] [-f] [-n]
-
-FLAGS
-  -f, --force                  Ignore non-existing features
-  -i, --feature-id=<value>...  [default: -] Feature IDs to delete
-  -n, --dry-run                Only show what would be delete
-      --config-file=<value>    Use this config file (mostly for testing)
-      --profile=<value>        Use credentials from this profile
-
-DESCRIPTION
-  Delete one or more features by ID
-
-  Note that deleting a child feature after deleting its parent will result in an error unless you set -f/--force.
-```
-
-_See code:
-[src/commands/feature/delete.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/delete.ts)_
-
-## `apollo feature edit`
-
-Edit features using an appropiate json input
-
-```
-USAGE
-  $ apollo feature edit [--profile <value>] [--config-file <value>] [-j <value>]
-
-FLAGS
-  -j, --json-input=<value>   [default: -] Json string or json file or "-" to read json from stdin
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Edit features using an appropiate json input
-
-  Edit a feature by submitting a json input with all the required attributes for Apollo to process it. This is a very
-  low level command which most users probably do not need.
-
-  Input may be a json string or a json file and it may be an array of changes. This is an example input for editing
-  feature type:
-
-  {
-  "typeName": "TypeChange",
-  "changedIds": [
-  "6613f7d22c957525d631b1cc"
-  ],
-  "assembly": "6613f7d1360321540a11e5ed",
-  "featureId": "6613f7d22c957525d631b1cc",
-  "oldType": "BAC",
-  "newType": "G_quartet"
-  }
-
-EXAMPLES
-  Editing by passing a json to stdin:
-
-    echo '{"typeName": ... "newType": "G_quartet"}' | apollo feature edit -j -
-```
-
-_See code:
-[src/commands/feature/edit.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/edit.ts)_
-
-## `apollo feature edit-attribute`
-
-Add, edit, or view a feature attribute
-
-```
-USAGE
-  $ apollo feature edit-attribute -a <value> [--profile <value>] [--config-file <value>] [-i <value>] [-v <value>] [-d]
-
-FLAGS
-  -a, --attribute=<value>    (required) Attribute key to add or edit
-  -d, --delete               Delete this attribute
-  -i, --feature-id=<value>   [default: -] Feature ID to edit or "-" to read it from stdin
-  -v, --value=<value>...     New attribute value. Separated mutliple values by space to them as a list. If unset return
-                             current value
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Add, edit, or view a feature attribute
-
-  Be aware that there is no checking whether attributes names and values are valid. For example, you can create
-  non-unique ID attributes or you can set gene ontology terms to non-existing terms
-
-EXAMPLES
-  Add attribute "domains" with a list of values:
-
-    $ apollo feature edit-attribute -i 66...3f -a domains -v ABC PLD
-
-  Print values in "domains" as json array:
-
-    $ apollo feature edit-attribute -i 66...3f -a domains
-
-  Delete attribute "domains"
-
-    $ apollo feature edit-attribute -i 66...3f -a domains -d
-```
-
-_See code:
-[src/commands/feature/edit-attribute.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/edit-attribute.ts)_
-
-## `apollo feature edit-coords`
-
-Edit feature start and/or end coordinates
-
-```
-USAGE
-  $ apollo feature edit-coords [--profile <value>] [--config-file <value>] [-i <value>] [-s <value>] [-e <value>]
-
-FLAGS
-  -e, --end=<value>          New end coordinate (1-based)
-  -i, --feature-id=<value>   [default: -] Feature ID to edit or "-" to read it from stdin
-  -s, --start=<value>        New start coordinate (1-based)
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Edit feature start and/or end coordinates
-
-  If editing a child feature that new coordinates must be within the parent's coordinates.To get the identifier of the
-  feature to edit consider using `apollo feature get` or `apollo feature search`
-
-EXAMPLES
-  Edit start and end:
-
-    $ apollo feature edit-coords -i abc...xyz -s 10 -e 1000
-
-  Edit end and leave start as it is:
-
-    $ apollo feature edit-coords -i abc...xyz -e 2000
-```
-
-_See code:
-[src/commands/feature/edit-coords.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/edit-coords.ts)_
-
-## `apollo feature edit-type`
-
-Edit or view feature type
-
-```
-USAGE
-  $ apollo feature edit-type [--profile <value>] [--config-file <value>] [-i <value>] [-t <value>]
-
-FLAGS
-  -i, --feature-id=<value>   [default: -] Feature ID to edit or "-" to read it from stdin
-  -t, --type=<value>         Assign feature to this type. If unset return the current type
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Edit or view feature type
-
-  Feature type is column 3 in gff format.It must be a valid sequence ontology term although but the valifdity of the new
-  term is not checked.
-```
-
-_See code:
-[src/commands/feature/edit-type.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/edit-type.ts)_
-
-## `apollo feature get`
-
-Get features in assembly, reference sequence or genomic window
-
-```
-USAGE
-  $ apollo feature get [--profile <value>] [--config-file <value>] [-a <value>] [-r <value>] [-s <value>] [-e
-    <value>]
-
-FLAGS
-  -a, --assembly=<value>     Find input reference sequence in this assembly
-  -e, --end=<value>          End coordinate
-  -r, --refseq=<value>       Reference sequence. If unset, query all sequences
-  -s, --start=<value>        [default: 1] Start coordinate (1-based)
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Get features in assembly, reference sequence or genomic window
-
-EXAMPLES
-  Get all features in myAssembly:
-
-    $ apollo feature get -a myAssembly
-
-  Get features intersecting chr1:1..1000. You can omit the assembly name if there are no other reference sequences
-  named chr1:
-
-    $ apollo feature get -a myAssembly -r chr1 -s 1 -e 1000
-```
-
-_See code:
-[src/commands/feature/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/get.ts)_
-
-## `apollo feature get-id`
-
-Get features given their identifiers
-
-```
-USAGE
-  $ apollo feature get-id [--profile <value>] [--config-file <value>] [-i <value>]
-
-FLAGS
-  -i, --feature-id=<value>...  [default: -] Retrieves feature with these IDs. Use "-" to read IDs from stdin (one per
-                               line)
-      --config-file=<value>    Use this config file (mostly for testing)
-      --profile=<value>        Use credentials from this profile
-
-DESCRIPTION
-  Get features given their identifiers
-
-  Invalid identifiers or identifiers not found in the database will be silently ignored
-
-EXAMPLES
-  Get features for these identifiers:
-
-    $ apollo feature get-id -i abc...zyz def...foo
-```
-
-_See code:
-[src/commands/feature/get-id.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/get-id.ts)_
-
-## `apollo feature import INPUT-FILE`
-
-Import features from local gff file
-
-```
-USAGE
-  $ apollo feature import INPUT-FILE -a <value> [--profile <value>] [--config-file <value>] [-d]
-
-ARGUMENTS
-  INPUT-FILE  Input gff file
-
-FLAGS
-  -a, --assembly=<value>     (required) Import into this assembly name or assembly ID
-  -d, --delete-existing      Delete existing features before importing
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Import features from local gff file
-
-  By default, features are added to the existing ones.
-
-EXAMPLES
-  Delete features in myAssembly and then import features.gff3:
-
-    $ apollo feature import features.gff3 -d -a myAssembly
-```
-
-_See code:
-[src/commands/feature/import.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/import.ts)_
-
-## `apollo feature search`
-
-Free text search for feature in one or more assemblies
-
-```
-USAGE
-  $ apollo feature search -t <value> [--profile <value>] [--config-file <value>] [-a <value>]
-
-FLAGS
-  -a, --assembly=<value>...  Assembly names or IDs to search; use "-" to read it from stdin. If omitted search all
-                             assemblies
-  -t, --text=<value>         (required) Search for this text query
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Free text search for feature in one or more assemblies
-
-  Return features matching a query string. This command searches only in:
-
-  - Attribute *values* (not attribute names)
-  - Source field (which in fact is stored as an attribute)
-  - Feature type
-
-  The search mode is:
-
-  - Case insensitive
-  - Match only full words, but not necessarily the full value
-  - Common words are ignored. E.g. "the", "with"
-
-  For example, given this feature:
-
-  chr1 example SNP 10 30 0.987 . . "someKey=Fingerprint BAC with reads"
-
-  Queries "bac" or "mRNA" return the feature. Instead these queries will NOT match:
-
-  - "someKey"
-  - "with"
-  - "Finger"
-  - "chr1"
-  - "0.987"
-
-EXAMPLES
-  Search "bac" in these assemblies:
-
-    $ apollo feature search -a mm9 mm10 -t bac
-```
-
-_See code:
-[src/commands/feature/search.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/search.ts)_
-
-## `apollo file delete`
-
-Delete files from the Apollo server
-
-```
-USAGE
-  $ apollo file delete [--profile <value>] [--config-file <value>] [-i <value>]
-
-FLAGS
-  -i, --file-id=<value>...   [default: -] IDs of the files to delete
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Delete files from the Apollo server
-
-  Deleted files are printed to stdout. See also `apollo file get` to list the files on the server
-
-EXAMPLES
-  Delete file multiple files:
-
-    $ apollo file delete -i 123...abc xyz...789
-```
-
-_See code:
-[src/commands/file/delete.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/delete.ts)_
-
-## `apollo file download`
-
-Download a file from the Apollo server
-
-```
-USAGE
-  $ apollo file download [--profile <value>] [--config-file <value>] [-i <value>] [-o <value>]
-
-FLAGS
-  -i, --file-id=<value>      [default: -] ID of the file to download
-  -o, --output=<value>       Write output to this file or "-" for stdout. Default to the name of the uploaded file.
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Download a file from the Apollo server
-
-  See also `apollo file get` to list the files on the server
-
-EXAMPLES
-  Download file with id xyz
-
-    $ apollo file download -i xyz -o genome.fa
-```
-
-_See code:
-[src/commands/file/download.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/download.ts)_
-
-## `apollo file get`
-
-Get list of files uploaded to the Apollo server
-
-```
-USAGE
-  $ apollo file get [--profile <value>] [--config-file <value>] [-i <value>]
-
-FLAGS
-  -i, --file-id=<value>...   Get files matching this IDs
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Get list of files uploaded to the Apollo server
-
-  Print to stdout the list of files in json format
-
-EXAMPLES
-  Get files by id:
-
-    $ apollo file get -i xyz abc
-```
-
-_See code:
-[src/commands/file/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/get.ts)_
-
-## `apollo file upload INPUT-FILE`
-
-Upload a local file to the Apollo server
-
-```
-USAGE
-  $ apollo file upload INPUT-FILE [--profile <value>] [--config-file <value>] [-t
-    text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi] [-z | -d]
-
-ARGUMENTS
-  INPUT-FILE  Local file to upload
-
-FLAGS
-  -d, --decompressed         Override autodetection and instruct that input is decompressed
-  -t, --type=<option>        Set file type or autodetected it if not set.
-                             NB: There is no check for whether the file complies to this type
-                             <options: text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi>
-  -z, --gzip                 Override autodetection and instruct that input is gzip compressed
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Upload a local file to the Apollo server
-
-  This command only uploads a file and returns the corresponding file id.
-  To add an assembly based on this file or to upload & add an assembly in a single pass   see `apollo assembly
-  add-from-fasta` and `add-from-gff`
-
-EXAMPLES
-  Upload local file, type auto-detected:
-
-    $ apollo file upload genome.fa > file.json
-```
-
-_See code:
-[src/commands/file/upload.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/upload.ts)_
 
 ## `apollo help [COMMANDS]`
 
@@ -896,249 +52,4 @@ DESCRIPTION
 _See code:
 [@oclif/plugin-help](https://github.com/oclif/plugin-help/blob/v6.0.8/src/commands/help.ts)_
 
-## `apollo jbrowse get-config`
-
-Get JBrowse configuration from Apollo
-
-```
-USAGE
-  $ apollo jbrowse get-config [--profile <value>] [--config-file <value>]
-
-FLAGS
-  --config-file=<value>  Use this config file (mostly for testing)
-  --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Get JBrowse configuration from Apollo
-
-  Print to stdout the JBrowse configuration from Apollo in JSON format
-
-EXAMPLES
-  Get JBrowse configuration:
-
-    $ apollo jbrowse get-config > config.json
-```
-
-_See code:
-[src/commands/jbrowse/get-config.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/jbrowse/get-config.ts)_
-
-## `apollo jbrowse set-config INPUTFILE`
-
-Set JBrowse configuration
-
-```
-USAGE
-  $ apollo jbrowse set-config INPUTFILE [--profile <value>] [--config-file <value>]
-
-ARGUMENTS
-  INPUTFILE  JBrowse configuration file
-
-FLAGS
-  --config-file=<value>  Use this config file (mostly for testing)
-  --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Set JBrowse configuration
-
-  Set JBrowse configuration in Apollo collaboration server
-
-EXAMPLES
-  Add JBrowse configuration:
-
-    $ apollo jbrowse set-config config.json
-```
-
-_See code:
-[src/commands/jbrowse/set-config.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/jbrowse/set-config.ts)_
-
-## `apollo login`
-
-Login to Apollo
-
-```
-USAGE
-  $ apollo login [--profile <value>] [--config-file <value>] [-a <value>] [-u <value>] [-p <value>] [-f]
-    [--port <value>]
-
-FLAGS
-  -a, --address=<value>      Address of Apollo server
-  -f, --force                Force re-authentication even if user is already logged in
-  -p, --password=<value>     Password for <username>
-  -u, --username=<value>     Username for root login
-      --config-file=<value>  Use this config file (mostly for testing)
-      --port=<value>         [default: 3000] Get token by listening to this port number (usually this is >= 1024 and <
-                             65536)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Login to Apollo
-
-  Use the provided credentials to obtain and save the token to access Apollo. Once the token for the given profile has
-  been saved in the configuration file, users do not normally need to execute this command again unless the token has
-  expired. To setup a new profile use "apollo config"
-
-EXAMPLES
-  The most basic and probably most typical usage is to login using the default profile in configuration file:
-
-    $ apollo login
-
-  Login with a different profile:
-
-    $ apollo login --profile my-profile
-```
-
-_See code:
-[src/commands/login.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/login.ts)_
-
-## `apollo logout`
-
-Logout of Apollo
-
-```
-USAGE
-  $ apollo logout [--profile <value>] [--config-file <value>]
-
-FLAGS
-  --config-file=<value>  Use this config file (mostly for testing)
-  --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Logout of Apollo
-
-  Logout by removing the access token from the selected profile
-
-EXAMPLES
-  Logout default profile:
-
-    $ apollo logout
-
-  Logout selected profile
-
-    $ apollo logout --profile my-profile
-```
-
-_See code:
-[src/commands/logout.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/logout.ts)_
-
-## `apollo refseq add-alias INPUT-FILE`
-
-Add reference name aliases from a file
-
-```
-USAGE
-  $ apollo refseq add-alias INPUT-FILE -a <value> [--profile <value>] [--config-file <value>]
-
-ARGUMENTS
-  INPUT-FILE  Input refname alias file
-
-FLAGS
-  -a, --assembly=<value>     (required) Name for this assembly.
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Add reference name aliases from a file
-
-  Reference name aliasing is a process to make chromosomes that are named slightly differently but which refer to the
-  same thing render properly. This command reads a file with reference name aliases and adds them to the database.
-
-EXAMPLES
-  Add reference name aliases:
-
-    $ apollo refseq add-alias alias.txt -a myAssembly
-```
-
-_See code:
-[src/commands/refseq/add-alias.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/refseq/add-alias.ts)_
-
-## `apollo refseq get`
-
-Get reference sequences
-
-```
-USAGE
-  $ apollo refseq get [--profile <value>] [--config-file <value>] [-a <value>]
-
-FLAGS
-  -a, --assembly=<value>...  Get reference sequences for these assembly names or IDs; use - to read it from stdin
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Get reference sequences
-
-  Output the reference sequences in one or more assemblies in json format. This command returns the sequence
-  characteristics (e.g., name, ID, etc), not the DNA sequences. Use `assembly sequence` for that.
-
-EXAMPLES
-  All sequences in the database:
-
-    $ apollo refseq get
-
-  Only sequences for these assemblies:
-
-    $ apollo refseq get -a mm9 mm10
-```
-
-_See code:
-[src/commands/refseq/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/refseq/get.ts)_
-
-## `apollo status`
-
-View authentication status
-
-```
-USAGE
-  $ apollo status [--profile <value>] [--config-file <value>]
-
-FLAGS
-  --config-file=<value>  Use this config file (mostly for testing)
-  --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  View authentication status
-
-  This command returns "<profile>: Logged in" if the selected profile has an access token and "<profile>: Logged out"
-  otherwise.Note that this command does not check the validity of the access token.
-```
-
-_See code:
-[src/commands/status.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/status.ts)_
-
-## `apollo user get`
-
-Get list of users
-
-```
-USAGE
-  $ apollo user get [--profile <value>] [--config-file <value>] [-u <value>] [-r <value>]
-
-FLAGS
-  -r, --role=<value>         Get users with this role
-  -u, --username=<value>     Find this username
-      --config-file=<value>  Use this config file (mostly for testing)
-      --profile=<value>      Use credentials from this profile
-
-DESCRIPTION
-  Get list of users
-
-  If set, filters username and role must be both satisfied to return an entry
-
-EXAMPLES
-  By username:
-
-    $ apollo user get -u Guest
-
-  By role:
-
-    $ apollo user get -r admin
-
-  Use jq for more control:
-
-    $ apollo user get | jq '.[] | select(.createdAt > "2024-03-18")'
-```
-
-_See code:
-[src/commands/user/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/user/get.ts)_
-
 <!-- commandsstop -->
diff --git a/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts b/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts
index fee9d4890..f484cb857 100644
--- a/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts
+++ b/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts
@@ -7,6 +7,11 @@ import { ObjectId } from 'bson'
 import { FileCommand } from '../../fileCommand.js'
 import { queryApollo, submitAssembly } from '../../utils.js'
 import { Response } from 'undici'
+import {
+  SerializedAddAssemblyAndFeaturesFromFileChange,
+  SerializedAddAssemblyFromExternalChange,
+  SerializedAddAssemblyFromFileChange,
+} from '@apollo-annotation/shared'
 
 export default class AddFasta extends FileCommand {
   static summary = 'Add a new assembly from fasta input'
@@ -30,7 +35,11 @@ export default class AddFasta extends FileCommand {
   static args = {
     input: Args.string({
       description:
-        'Input fasta file, local or remote, or id of a previously uploaded file',
+        "Input fasta file, local or remote, or id of a previously uploaded \
+file. For local or remote files, it is assumed the file is bgzip'd with \
+`bgzip` and indexed with `samtools faidx`. The indexes are assumed to be at \
+<my.fasta.gz>.fai and <my.fasta.gz>.gzi unless the options --fai and --gzi are \
+provided.",
       required: true,
     }),
   }
@@ -40,21 +49,16 @@ export default class AddFasta extends FileCommand {
       char: 'a',
       description: 'Name for this assembly. Use the file name if omitted',
     }),
-    index: Flags.string({
-      char: 'x',
-      description: 'URL of the index. Required if input is an external source',
-    }),
     force: Flags.boolean({
       char: 'f',
       description: 'Delete existing assembly, if it exists',
     }),
-    'not-editable': Flags.boolean({
-      char: 'n',
+    editable: Flags.boolean({
+      char: 'e',
       description:
-        "The fasta sequence is not editable. Apollo will not load it into \
-the database and instead use the provided indexes to query it. This option assumes \
-the fasta file is bgzip'd with `bgzip` and indexed with `samtools faidx`. \
-Indexes should be named <my.fasta.gz>.gzi and <my.fasta.gz>.fai unless options --fai and --gzi are set",
+        'Instead of using indexed fasta lookup, the sequence is loaded into \
+the Apollo database and is editable. Use with caution, as editing the sequence \
+often has unintended side effects.',
     }),
     fai: Flags.string({
       description: 'Fasta index of the (not-editable) fasta file',
@@ -90,22 +94,46 @@ Indexes should be named <my.fasta.gz>.gzi and <my.fasta.gz>.fai unless options -
     )
     const isExternal = isValidHttpUrl(args.input)
 
-    let body
+    let body:
+      | SerializedAddAssemblyFromFileChange
+      | SerializedAddAssemblyFromExternalChange
     if (isExternal) {
-      if (flags.index === undefined) {
-        this.error(
-          'Please provide the URL to the index of the external fasta file',
-        )
-      }
+      const fai = flags.fai ?? `${args.input}.fai`
+      const gzi = flags.gzi ?? `${args.input}.gzi`
       body = {
         assemblyName,
         typeName: 'AddAssemblyFromExternalChange',
-        externalLocation: {
-          fa: args.input,
-          fai: flags.index,
-        },
+        externalLocation: { fa: args.input, fai, gzi },
+        assembly: new ObjectId().toHexString(),
+      }
+    } else if (flags.editable) {
+      if (!isExternal && !fs.existsSync(args.input) && !fastaIsFileId) {
+        this.error(`Input "${args.input}" is not valid`)
+      }
+      let isGzip = args.input.endsWith('.gz')
+      if (flags.gzip) {
+        isGzip = true
       }
-    } else if (flags['not-editable']) {
+      if (flags.decompressed) {
+        isGzip = false
+      }
+
+      const fileId = fastaIsFileId
+        ? args.input
+        : await this.uploadFile(
+            access.address,
+            access.accessToken,
+            args.input,
+            'text/x-fasta',
+            isGzip,
+          )
+      body = {
+        assemblyName,
+        fileIds: { fa: fileId },
+        typeName: 'AddAssemblyFromFileChange',
+        assembly: new ObjectId().toHexString(),
+      }
+    } else {
       const gzi = flags.gzi ?? `${args.input}.gzi`
       const fai = flags.fai ?? `${args.input}.fai`
 
@@ -164,41 +192,10 @@ Indexes should be named <my.fasta.gz>.gzi and <my.fasta.gz>.fai unless options -
       body = {
         assemblyName,
         typeName: 'AddAssemblyFromFileChange',
-        fileIds: {
-          fa: faId,
-          fai: faiId,
-          gzi: gziId,
-        },
-      }
-    } else {
-      if (!isExternal && !fs.existsSync(args.input) && !fastaIsFileId) {
-        this.error(`Input "${args.input}" is not valid`)
-      }
-      let isGzip = args.input.endsWith('.gz')
-      if (flags.gzip) {
-        isGzip = true
-      }
-      if (flags.decompressed) {
-        isGzip = false
-      }
-
-      const fileId = fastaIsFileId
-        ? args.input
-        : await this.uploadFile(
-            access.address,
-            access.accessToken,
-            args.input,
-            'text/x-fasta',
-            isGzip,
-          )
-      body = {
-        assemblyName,
-        fileIds: { fa: fileId },
-        typeName: 'AddAssemblyFromFileChange',
+        fileIds: { fa: faId, fai: faiId, gzi: gziId },
         assembly: new ObjectId().toHexString(),
       }
     }
-
     const rec = await submitAssembly(
       access.address,
       access.accessToken,
diff --git a/packages/apollo-cli/src/utils.ts b/packages/apollo-cli/src/utils.ts
index c3b372a31..4f50a7af6 100644
--- a/packages/apollo-cli/src/utils.ts
+++ b/packages/apollo-cli/src/utils.ts
@@ -3,7 +3,11 @@ import EventEmitter from 'node:events'
 import * as fs from 'node:fs'
 import { stdin, stderr } from 'node:process'
 
-import { type SerializedDeleteAssemblyChange } from '@apollo-annotation/shared'
+import {
+  SerializedAddAssemblyFromExternalChange,
+  SerializedAddAssemblyFromFileChange,
+  type SerializedDeleteAssemblyChange,
+} from '@apollo-annotation/shared'
 
 import { Agent, RequestInit, Response, fetch } from 'undici'
 
@@ -353,43 +357,29 @@ export const waitFor = <T>(
   return promise
 }
 
-interface bodyFastaFile {
-  assemblyName: string
-  typeName: string
-  fileIds: { fa: string }
-  assembly: string
-}
-interface bodyIndexedFiles {
-  assemblyName: string
-  typeName: string
-  fileIds: {
-    fa: string
-    fai: string
-    gzi: string
-  }
-}
-interface bodyExternalFile {
-  assemblyName: string
-  typeName: string
-  externalLocation: {
-    fa: string
-    fai: string
-  }
-}
-
 export async function submitAssembly(
   address: string,
   accessToken: string,
-  body: bodyFastaFile | bodyExternalFile | bodyIndexedFiles,
+  body:
+    | SerializedAddAssemblyFromFileChange
+    | SerializedAddAssemblyFromExternalChange,
   force: boolean,
 ): Promise<object> {
   let assemblies = await queryApollo(address, accessToken, 'assemblies')
-  for (const x of (await assemblies.json()) as object[]) {
-    if (x['name' as keyof typeof x] === body.assemblyName) {
-      if (force) {
-        await deleteAssembly(address, accessToken, x['_id' as keyof typeof x])
-      } else {
-        throw new Error(`Error: Assembly "${body.assemblyName}" already exists`)
+  for (const x of (await assemblies.json()) as {
+    name: string
+    _id: string
+  }[]) {
+    const addedAssemblies = 'changes' in body ? body.changes : [body]
+    for (const addedAssembly of addedAssemblies) {
+      if (x.name === addedAssembly.assemblyName) {
+        if (force) {
+          await deleteAssembly(address, accessToken, x._id)
+        } else {
+          throw new Error(
+            `Error: Assembly "${addedAssembly.assemblyName}" already exists`,
+          )
+        }
       }
     }
   }
@@ -413,12 +403,18 @@ export async function submitAssembly(
     throw new Error(errorMessage)
   }
   assemblies = await queryApollo(address, accessToken, 'assemblies')
-  for (const x of (await assemblies.json()) as object[]) {
-    if (x['name' as keyof typeof x] === body.assemblyName) {
-      return x
+  for (const x of (await assemblies.json()) as {
+    name: string
+    _id: string
+  }[]) {
+    const addedAssemblies = 'changes' in body ? body.changes : [body]
+    for (const addedAssembly of addedAssemblies) {
+      if (x.name === addedAssembly.assemblyName) {
+        return x
+      }
     }
   }
-  throw new Error(`Failed to retrieve assembly ${body.assemblyName}`)
+  throw new Error(`Failed to retrieve assembly from ${body.assembly}`)
 }
 
 export async function readStdin() {

From 00d6606aa5559a3b7ef7a5cc489be3bdca7bce7d Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 21 Oct 2024 17:55:45 +0000
Subject: [PATCH 04/10] Remove external dependency from test

---
 .github/workflows/pull_request.yml              |   1 +
 .github/workflows/reload_demo_data.yml          |   6 ++----
 packages/apollo-cli/test/test.py                |   5 +----
 .../apollo-collaboration-server/package.json    |   1 +
 .../test/data/volvox.fa.gz                      | Bin 0 -> 16251 bytes
 .../test/data/volvox.fa.gz.fai                  |   2 ++
 .../test/data/volvox.fa.gz.gzi                  | Bin 0 -> 8 bytes
 yarn.lock                                       |   1 +
 8 files changed, 8 insertions(+), 8 deletions(-)
 create mode 100644 packages/apollo-collaboration-server/test/data/volvox.fa.gz
 create mode 100644 packages/apollo-collaboration-server/test/data/volvox.fa.gz.fai
 create mode 100644 packages/apollo-collaboration-server/test/data/volvox.fa.gz.gzi

diff --git a/.github/workflows/pull_request.yml b/.github/workflows/pull_request.yml
index 52ad1fc67..d823790f7 100644
--- a/.github/workflows/pull_request.yml
+++ b/.github/workflows/pull_request.yml
@@ -40,6 +40,7 @@ jobs:
         working-directory: packages/jbrowse-plugin-apollo
       - name: Start apollo
         run: |
+          yarn --cwd packages/apollo-collaboration-server/test/data/ serve --listen 3131 &
           yarn --cwd packages/apollo-shared start &
           ALLOW_ROOT_USER=true ROOT_USER_NAME=admin ROOT_USER_PASSWORD=pass yarn --cwd packages/apollo-collaboration-server start &
       - name: Run CLI tests
diff --git a/.github/workflows/reload_demo_data.yml b/.github/workflows/reload_demo_data.yml
index 807d047d2..a332be577 100644
--- a/.github/workflows/reload_demo_data.yml
+++ b/.github/workflows/reload_demo_data.yml
@@ -89,16 +89,14 @@ jobs:
             /data/schistosoma_haematobium.TD2_PRJEB44434.WBPS19.genomic.fa.gz \
             --fai /data/schistosoma_haematobium.TD2_PRJEB44434.WBPS19.genomic.fa.gz.fai \
             --gzi /data/schistosoma_haematobium.TD2_PRJEB44434.WBPS19.genomic.fa.gz.gzi \
-            --assembly 'Schistosoma haematobium' \
-            --not-editable
+            --assembly 'Schistosoma haematobium'
 
           apollo assembly \
             add-from-fasta \
             /data/schistosoma_mansoni.PRJEA36577.WBPS19.genomic.fa.gz \
             --fai /data/schistosoma_mansoni.PRJEA36577.WBPS19.genomic.fa.gz.fai \
             --gzi /data/schistosoma_mansoni.PRJEA36577.WBPS19.genomic.fa.gz.gzi \
-            --assembly 'Schistosoma mansoni' \
-            --not-editable
+            --assembly 'Schistosoma mansoni'
 
           apollo feature \
             import \
diff --git a/packages/apollo-cli/test/test.py b/packages/apollo-cli/test/test.py
index 8d414be5e..e0436d3be 100755
--- a/packages/apollo-cli/test/test.py
+++ b/packages/apollo-cli/test/test.py
@@ -299,10 +299,7 @@ def testAddAssemblyFromLocalFasta(self):
 
     def testAddAssemblyFromExternalFasta(self):
         p = shell(
-            f"""{apollo} assembly add-from-fasta {P} -a vv1 -f \
-                https://raw.githubusercontent.com/GMOD/Apollo3/main/packages/apollo-collaboration-server/test/data/volvox.fa \
-                -x https://raw.githubusercontent.com/GMOD/Apollo3/main/packages/apollo-collaboration-server/test/data/volvox.fa.fai
-                  """
+            f"{apollo} assembly add-from-fasta {P} -a vv1 -f http://localhost:3131/volvox.fa.gz"
         )
         out = json.loads(p.stdout)
         self.assertTrue("fa" in out["externalLocation"].keys())
diff --git a/packages/apollo-collaboration-server/package.json b/packages/apollo-collaboration-server/package.json
index 31031c929..2b796778d 100644
--- a/packages/apollo-collaboration-server/package.json
+++ b/packages/apollo-collaboration-server/package.json
@@ -109,6 +109,7 @@
     "jest": "^29.6.2",
     "mongodb": "^4.7.0",
     "rimraf": "^3.0.2",
+    "serve": "^14.0.1",
     "source-map-support": "^0.5.20",
     "supertest": "^6.1.3",
     "ts-jest": "^29.1.1",
diff --git a/packages/apollo-collaboration-server/test/data/volvox.fa.gz b/packages/apollo-collaboration-server/test/data/volvox.fa.gz
new file mode 100644
index 0000000000000000000000000000000000000000..eb7b2995849794eae6246026476a9c4d911f9f18
GIT binary patch
literal 16251
zcma*uLy#>DtRUdlZJW1k+qP}nwr$(CZ5y}k)3$B9-~VQIvzjcDO4g|?QuX0SLxKVQ
zZ~TG-2?>J$>G5CZO4pf6JL!BfMqxn(s<7>VIf1}q>>CN22=n<vMzqqrm@4D8HVshq
zrF-6TexmH-GdoB7U*_unZu~yq{(kH}<Nv<b|J46({bm4Kxw`?(tli4X&zG<Kzh6Jk
zr*rlGKkxr_^}GH*Uq9b-`Mdsp_UgAcD{AuB>l>BZncF+tS$03RQ~dP5_2yn))oxzZ
z-lr<pa<Z!SbKjAf=e3!2Roi{}+pogqUhS`bUaGI>xi@vSRo7KnncG?3_}i+gyszQi
zRpxCsq{}Mqxd$lSH}Y<CZp$~{W9wRd)+c_GEbXhCy{zRo+e<IAvo^Qi8M&WG+N!$D
z+^pLFl+S9t#h1;ks@luk-+DU{Ox&{Nw=zFPUyE<~XK!p=Un@U7yl%CtKF7OG{O)?W
z>HVy_JzjLb=3dq-YcDp|wRT+RzJtAgz484J@}2r!%TM&?cl7)Co%l^}q&wN&`%~L>
zw~l%*E4!t-+%NB7J8pe%i><TgHv6OxceJ*n`>Bupwkh?UF#6e@`CHpB`TljAcz5-d
zd5;0Qx4paCZ_AfIUbSBzKIrzVc0P-{xw&6$x8~OBxVlvVeNo*KW~1`jySu%Cef<a2
zSGiTZyxYpJcvbBy2$h&Cm)myU{Pwr1sH-hB$m%waEU$diUDlqr`gcLMD_!#UcKe^7
z;ma$pWS?}om3;`YszdBM?lT}=_I2IfCo1=#HS6Bb?%#9YcPF{q`j~86FTUm4+vRHp
zubNF9H)%$|a@)TSy*@6h-+;VaUUykEY0EVr)-RIy`yJ!g-o}&TW&v}#&g>Vx3*S6<
z-fQ2ZR9;{Hh~@dPs$6E8t520Subt?dgZQn~*X?CQ>YK1#-e&jG=k1!~Ya8{)m0Rf!
zgoZU+_vCF+eeahar^fx$AEWxqT~^cSnl5`k>)W*K4QKtVg=27hbkx;(cg@{iHQ(Wt
z?aWt%@=KP&g7nv=S7^A<*G#tRy}GJTqMOBT`R6NLBIn?}opM)WUGw!V{(kKGTihLa
z8oQ4z2={z&b$<+n-QVgw>>1BR_wuc9H{*XQubuP(^YgE`Td^&4&)x8sVPD;4HxLN&
z-k&5|FUT6Vy6UUjLty*e=C{7P+<BiY5qYoP_D^;{Vd_r#0AI;r*Dd$?L+@Vf<E?Gg
z8GsSQYV1|>$p9(2Q~!v-ixe(X3RHxFbV4_EL-~7qU%RzPZ@guh{9K%TPRC$ce`Rg6
z=q>ZX`tH9)SM{aN?9-iV8vdP-&1`5*s#o0YT}r^%j;qfNJmDjXp8Y6o`xLV9%|kC{
zqdl7`>o&uYHId$f(}|rqQ=jL{&j%KKOrAH&=k|kZdyn)s#hfj?d_IFOyULtwqfMox
zS0DYC-$GYmxQ*yjw|wfN<%h~{E5AGAwy$&pt#pph!8Vs{iKWpM4x1&y>M$+Kf@4yk
zhnze0GTbh^m<&GCL~mX9_A9MGb)sqJ(hhbnf&=C2$zL4ZQ64kAWete;vh6amfzQ3U
z2Wrs+oc;iRjmHqEVWmn>e&^ty@5bKOZTHum>aM`1=^T<@(n(hPgpJ2PpI06)W2pA~
zKSjsGx*a9gmATITK_E$M-s#BL=|cqcX(LYRIseWu`@>#SV|V<xSZ6&7-7mWfFTuYJ
z`%&y}W=Rhad(3Gmxj55DTv7HjKWSe}Yf5FYN7v~7mG#=6+AU+G+xd|xp$Enp1@w-x
zH3jJDuj-ET<QmV&3yK!?+h6v{x9#_qe!3<r1+TeEAdqErBj3iesKTgQ;B|JM))ip0
zTj~3q0Pl#)O7z!1>5*qA^-ev~IIVX6gOhgjogfL!>p5gI-0tsAjEztTC(25dtLxeo
ztxV-|wCm}OKM#}6gX+96Ywr6Mez13c_%_me`=(}M4=ii9i=qu`?4%Vv`leXPDKzqY
zb@yjSBPb=c#Vni?dPP5Z^~+8fE8TK%cAsi&rqHf+mF`IV?^bto=Y%82be$(?M##SU
zSGrTIbsTDMY|l*QWwLH5)a<GZb9KOQ_Rf8O?O$3@+r9N*u<M@cjritCd-ZRA^Z{C1
zHPcYBttVR9r*n8z*qD6-BIot{FNs4*F@MPFwuJ>w{_R9}@jD1Fej~CWA7fNcC@n+Z
z^-XsNg||wum5LQbXlmDF->;mMBIsgi7U;&K25`5a`1%*W`|+LsDBgBr`cSr1NcY5i
zmM;yLH60YmOtcqwFSz!!cyfp99n?|h{VhDw!|cv1?~OEGAp}FRDm*##sc1*<oVz!R
zS9bAUsd;r?GktyT_e&t_w6%pScdgP9%T@sqQCJawCBBWFsqMRgIYhDB_mcj1zi20G
zcUA0jP|M10iheqXKa9_9^>(0sqm-mt3RG04)92G+uE$;fW2brP!?)Yk@(zZsvVF;I
zv(?>a&**%)|JiH&EB82Iy7fouP@8sXVI+uY6g;_;eITrw<*22VChW1#22y|k#gd*@
zam8$jo}w_tSXKa*X}1oIcR!AG6C4SPobAf6H0hA-eMW7>S9aKD$RO1*y!;j|Ky9J5
zG<)ZL(p-yga<u?oH(Yjf^4|ECbn6#EY_K&|6e9A}Z;lXV(RJ5Xn+EKXaCd-?LIA)X
zv5UjRKq>cRnm*=`|MD$9%<pg5WfrQ~(z=%@A2SAO=g_YDIZxK>`kK@Eo6xj$ZJ*Sm
z7<Q(wc{&qqo5chj*EY~!`RJ#)xeuH;UmrZXrQ5*lN@KgOa|CD&!7akNy%`nFuKyfn
zUjXLM5Mzf5BH3xfDIsfKnon1oIhS%PDl*01P0z^?RW(*d@N&r)2%ewz*OpreA6``o
zOrKL754oA@tI~y46E0v%v3f<<n7(BLV*Erk#b1T6P*5`!?c7F5+3!=RPV3GOKI$n8
zl8~;I(RTAc_Pf;3*Lf=Y1k=#Llgg4c!tf4DaMh<Pwa|3M@scV4ncx1Dd>K+PrON{W
zhHG%mwujy?%Ol!JZw#RrN&`z`sRcsL^EMwKIiiLpRd;A4x2Gr-BEEm3je<WO^5yZ&
zCd!v(0Tt1GSeWPB;V)-GBq%8<6z<5D(kXO@r7~`nn^N#yqy!lcfWY9l!)G}OLMF4s
z8<<IwKHr0vx|c}VIevaXmz0|Nqw5hKmW`9O%8E|DGZl-*1Bz@FxcSuSPh#Oqk2fEE
z(`=>0*mR{4>RvcAyKbV8g$aDwO$u6>DXis_6?J=JUMN@~$p)0mGFSuJ@VD){7_xpW
z!qvYr8@u1o$|jecyIf-=q`#X)9)M0?d*4R}IpEfDfb6f0%vvfsr<r7j7)F2i{4IQm
zX|VNFMx5?+MXccm_QD9?+$fMfG~wfV{FL`8S@0@`AV~Njbjiilc;NjWpgp4M5C%7H
zP=l5WPHL&`;_&_{Kp&$XNI23~TQ6#5Lw4)cOFt@RSas@BWF{>lfuo2DmG-AU_k-=1
z=2d6?hy5OCcY~^%!E<jbai1fUnp$!4$Ox-w3d4f}qxuPR{ju&H(1stj0tE-o0c9eH
z)K2NJPN?jPMU#jKChB<GsGSsxOA_<Xem(3738Y+5iyA$vWs_{{n#*XDeNsUacF>?U
zH%q$=wx|nU2Qt~>n4V*Sm;5U&b&`y_i7!SF9r@pNjI=4dwCx*JUS7waKl!v!r9#p;
z=>E=PIA?t%d+h!(PH-Rr&ul~DLcq>xEm$r^+YOZf&nRiHqM0Pv&2wcRuDMQUe;^Hp
zY<Ed;iDYlX8N3CyRYVMRo`RFmW&%4L%XZ%Emqq#>UM#O<dLZeBb|QkuT_&69()BEZ
zVYE%?l>J<ISu@Nql@+67qr$vn6BMqmtWTgT=#k4psN0RQxkgHGS&}v2zL>3<Z(XAv
zeC1{cAI8L!8^aBXj~ghgW`TScnv!q60jy*W*>9-d%z0`U5q1A!YF0!;3%(AvkRho6
z_3lha*6aRx3_Lu_m>D?LGSvK`?<6<}g~4e}F$|pDy^X*U4Ixvh>U0Y72wu^*M#d90
z*;L}?ox|sy<EdpymuSq6<27NR0e5U3qWGiX<l@)YKTnB%-ALkfB_hxPx*n4T;WW6?
zL)XsuA@qs)@_}%N%!CPl>e8fpyALJUy=<?{rwBJwk#(pW8sSi&IOu{KBO6)V3>=ty
z3X-h7THbc7B#iP=VY|i;t$#DI^mB}bSD)Y|bUXn839n<3Y{pGG=;ba8GkDy~<$$p*
zT0sP`kS@;-yMMQUE2<9?e4)q%Le+`Kl-Jql{J6b>NXc?QgJ9Goiz2@wcEZDkwKcxn
zGZ4+Y!I6K5gW9z3to1F>F-r?rE3^1nmv94;*t7=QU+f{*WJAj4ThLG7cbMzAR2zd6
zk*fJ9cB<(@iEkm<##XXWUQ5gE8ln)IBTfK)_TW5h^yW2Gk54-06rj4Z`zwMmZ5*f|
z%+{o|x_~+76Qbpw{UWCc-Ee9cx|M~YMqfz>8mA&q8_t(@6GcA)p!^U~_CAynk2v><
zSdtQ#u(Ik;gbt15L5MK4iG?a{qLfb*>P!kRu)mo9S&e|pX{$fZU3a10yW>wV6$i;=
zaoI8V57y4WU%{B+&XJ#QEvq7dw)e<fnvq|=%u-j5W^5n(7A?qXM-TZy$jd_c`(uvq
z5~LR%TLfzlQf#|Ne-ZK3{QQa?EJ+J{C!qS7#3ruiJt}kEQ1+tDao-UDc7-xhX=-gJ
z;z^n!QvAsg&{!dWpT6sxUM5}?)Js?ZckUeW+!?5u;EKVg%XPPWhae3hu9!Y%c+Dsd
zG?%2%L9ZZr|1ED3@|V<N6Nl2+5;)cQV3g&`Dslt98^3r{ypE4BnBJYZrdz@X=UlMb
zu&NgHh#QG8F*B8^0u1>iNw0jgr6vNEzJu&`<YIYIYNxgss<0Hh0uuX(fRa{8MDIv$
zjUQXW6f5D6Bhp#8Rlus?Fma@pCVDF3?iJx-GQ`;3Bzr)><6ezRMfz2uyPVU%VMlEx
znLTJW*Vyfn!-8z{EAZL`PaV{@p6)vvMcDu^dHY++wrRc=eg-@eiO4E(FBW9#Zf)m*
z$1En*4V$kU+h;n$AxdH@raAzDX&+{{Z$M%gdNuw<l^qqe$zStwvB^zQm7y6h{mIi>
z5zQSUi^p?Rw2498?AST0KjuN$ROim?A$ZTFks9;5MiQi(reT(yIGYX3K1r^TM)eF3
z*}ObG(<16p-JCOrc?$SdIWZ)-83n`r65P+TFP;~9KO=axc7P)i`}_UF&G`)$ilKXX
zbeMABI>Cb@v}(g(pW|%h-W1r!$<2BL#3M!9pQXj7*ZKNbobPE+J>s&QrDw%9Tk_jv
zyDH*yv}FW~<3k!cVjLx?f?Srxr(@%d@G$D4sd13tQ&GasX7ViTJQeMR2g(%cGI$ug
z{pid(-oODijoQqbPu5Ar%o?LC2<;qtPxmBoucMK~=d7$T&8Bi?afjGHmmp0=V8qGx
z^+?Ac5a6IHGihJwMwY>TMg2Cy5*l;oc^AnmoChnOAY!ZCx=`0(w=#)}xsVE@y^tN6
zbV)$1Z7=dSt<AcwBU3iCR5|HPxlIQY*xE2o&zXXydN8_9pf*<3$gFq@Y4gI{71omC
zOEgUmffuVI=Hq*zFn(+dd9WCN4yp?y{3~0?Y)i79wsS%M_AjcPWs*h5mJ6y5v#ERz
z<^uS|4gV+!%?<Xut%x-TSDfs3e-zv}8K%>6$Y*&mm;UV#Nys|S<BU?!yTdVZ7g<XI
z6rdPS@bd`|I!*?a$C8kx1fg}wUI;0pf1Ti@Mw*bJ;?q<%!d>}F-T5Koo~;xIq?Z+K
zgC+aYB2kkL{_JB_cMV0*S@)4bm(BQ_Py~=oh(X`v<qdO}6T}e++_#J*YYYTmYPj}t
zLnzK#=i^aI%5$Dv6#CHuFwev^F>7j#JHJ37>z}-^-8K;+aUI3zkdLS?m|R6%x~@_c
z!6dR5Hg(5dV>yNv(e?-LO2h<3T-q-2)n+o0{ZFMw2{;a7C*cLuz=%vLM=K!<ZP|ip
zV|}6ST51KfDQ(mVXcdBx(Qob9gpsh2#_fm?Mla5dyZQDA2qyPu$b)=7j445r)@KpD
z68Qn4Le)_Ba{v@H`|%0X+kaB}zELzS(p1%WQh+p66St~xLwKh?Dy<0IUH2WtOWyCy
z-yZKh*_2G_O09Qo%|+KI5>pT&gdxesj(I6VoRP}zyc7P^{E4QQ7=JjagXl)QBAF<w
z_IJ2jN2`|#)TEZCG@1bV(i@?x24*(LW!WxCeKg0w_k^p38M%gKV!sI@1wJ8pjX#6k
z3Xu}MprYv|7>dwa&ieVXxPN>=n+?PXzc-CS6_xU+E_xgCjwn{jH;YMueQ#`*s<xFM
zW^E{lS$S2EVH9*#UTP<ctK+u+Xp(%}n-l?EMQQkLA+@gIofhRG%dytiRxd;*Ea@{D
z662r+O+%Xo4bsp6KNNqx951XOd}=Q6&Df!$TcA<6t%^$8V);CHkXFe=t%RSn5NEcu
zB7K(2Yuz!JCYP~}fm&El6_Y5c7Rj|STn<yiZ$|QjQ^l74$p(zhi*wz~&P#(U0Exbn
zQLmis6jo14787OQyn~L>i?xP0)i?4BIFTqFiAdPztNLaOrpaUCz`}kfyHsfWfgRj8
zPSKL6Zt21dfXc{}Bmf#VIBM)27vMp1t1j4)6&Ag67m3qwWLhB67arA?w27({x8}|j
z^*O6#E)2>MqeiKu6qgk?+fbRHbm8E+YOTWFwNis4Dw$0Nd%rfBR5liu`(D9hDQdb&
zVJ=*1{#WJ3rkRBHgNWviYl;Tb$A&r^=Fj~pEPDf6NDx|;I2JP=TA@%ma!o$>E%~P1
zYo0cm$f@Skj4O8{mB&_)ES{QU&y^n67vq1vLHu5Qk@R~_4rIV6iGj=xLc6pyQKL|m
zcTZ(bBwXUc6sv~x&|dc0!Zhv%G{nYzF+0H$XszCr)as<tS8j9z_TNjyQdSJG6W&BM
zq|m*ux>;cmEb3my&e)P?f=;>1^$k4^hgv;v_TI}{1&5tkqB3qEHQ2u|9feFLN0v3@
z?b8OGRSkqQ{dCjz;JL_!vF<?w%Vo86!MhSH&oX>Qqgt-D2ai3G3R9TPsIhL`)yN$+
z?yvXSnIACBSZ&OIKWZv;CT9O_bl`*0xG<t9C~EaZJSak{Z?9&9JS|FhTG1M35)!&h
zZ#>Y{?oo@2`Oo*YF<7>?(oAAVV!%|HtE^se-4~}JEOvq#iyB5e!UxM`sm|Y37&p`-
zG{dP@i-C8clhg_vq)q;$7zzYaX$zI)0w@J60;tX3nMNn4p>gWn1vLqZFq>~ARu5SO
z&C;O|-5aH|R)XYA9+6bA4>V*Z!zl2r_SS<~jvTVlnaHgecPqTe45>dUef&fxY)j}~
zsoeX8qX|2Yhd2Z^vB!(fH$?(G?dB#Ks*Zf6&Dg$~CSDFa49L2yhL5S(bkdV1oT^U(
zL+3>5@4BZ-0F@F1ND65jNI8`Vcku58BF-Wow&5?Nkx+A$1{R+T3n3aLfx@k$B$Rwp
z>zW9v@8x2B!xZ`&KzE?ElEveOayk?~0=vf{ROVtlVUQzPB<X8uB2Bdz8HHuuhO^a`
zOzQ)3$x|O*iBlYu2vs())Ap1?oEl(*3aa$RY*_V?E#)5!T3)=TnzQ61QfBf6hXw|q
zC2!H?g$T7cMmtffln_zqpdJI41~Kr8w;v%qn`GKw23jT4j)phs$c;7Z>_s{k9{4!u
zU|5tXQK>U)iLVS)T&J3K)ftb1WNSLvH&SLLucbzcNMZ$nwUU9DE$s{oS5w}uvHhnA
zKZKO3rKgdB|1$?si~d&AD$K)-Q&BbU%S2RyDg3SwYp5jD^yrgIT#K?DbzWQf2B{z=
z6e2Ks?{6Fns@m|Fj9i>A(@-^6tO{n2?BdCuT;`|C8kL*Tz_IQkSCG&aXtv@==%xlP
z$vmkJN(jWg0ha7(4AR74yOSQ2CVR2N+t!aXY$|X$laq!?LQqU$a$N)p3#jy9W1OyJ
z`-7ePtlH^g*0+wnFKLQPnU@o*@)wlomcsfquUyq19_(`Vn*FhX9ztkVlp@e;3|?$R
zt|AxOjP%;&DBy)nB)@{6Y#c>$h@6#;>>+azn{?Ni>cV1P4WMFzX7y$3x<_-~fODcj
zP08S41*&QSZ%dL*$slhDg@;ZuTs!g1_8DL&4b+HJ<Jxu;f}7NIPHIpN*}@mK^?(vS
z^MvP39{nntzhqWFK_J&WO0Xqrj5!x>j_il<TPp}lJw~O*n8~$5+;5DL?nA6r!wupY
z3)G^gF!!X%1+;M*N0ve{hwL_@aYYUElQs<CAhqS~k-d&%v=J6pb`M&3oyJ+mEnp7|
z@`aUDgkD;cGAg)AM*$=uMe6bIKcYaLk7?IDq*Y&t@Q4QL!S`_Far;$v8Gsb22ZL#Y
zRBOw*>+erJ!d$LUiiScg!NF-WIK`Rc7_?vBrCvyX4w)usY-Y=~<L`!6%n8d)HLfYz
z+2dl>N*WvP^V1L4BshisyNM^}_&Ho-ts1|Hfsj}o+5Klo9L^h;)8imMNqhRMZ-z$V
zkwVElId;n+Bns2?j-0R9()3C8XLV9wjcz7+Ik8X6ny5(F`{_>39lz3R@L}L@ytvDT
zm`#e8aAjX|78<R-eZT~~Fid9(W}5h@D|23d{TOH`l03wf+g5l_JyMX<Pv+y(r~}@G
zoD6HAf`vYJ1PP1bGNX7Cnb9r_pNm@{7y*$CUs$@Am(m3{OD`e*YOJka9Bhk77}63P
zwH@u~LdX0m1tBt(T`-oed3CKup6LA5>8i0qJBktIS4PxEGS+dTiSo}1IDy$Ex1Sto
zw9je7iIi;GB#M<yCkc1e0k*9n>NuBrx*a1M5)WVvE3_rh*lEciE{t7^2F&3Eo3!cq
zq=B?OjD9}K3{)N*OG)xWp>`nxLN7x~B-4I4-p#NQJs8kMu09B=-DehG+_WMsMR)=@
z5f`dQ{P3KmZH97abwe0r%Qw3`Z5YuY8pAtTi|jq%Kn2Oru+nPr2JCbjMJGpU>}@4L
zgDpVuzM35u2^GWgK8AwyU&xl4twbBGMM^Y3x(U1eLzI|DHB@Tk2%E2xy2T_46xqWQ
zJjUPg^PMoEp67i{w2*I^K3E%-pcq4L+smCKng-o&QOC5ITltKpQca^%I%Eo2<G7e@
z=q6`S$?hS~DIFO!Gw>T?2J_wF6T;(SdWc#=;w~E02%gU$OvZX0FI2iUgA;GW8B3Wa
z<p{77KBdRL>IeSwVyKm4|5764sXB8NnKrZcSJUB--}N1b!kZo#>{(%w9d?hwJ&oXw
zd$iiarj5A3>|<t@Y*eiT-xyi&yunE}iN_mNC{+nW_u}3w@%h(MHVRmiSGH%23jllO
z+ayt-@=~0I4uYKEas*TE5~p$t{w$4aJ8{HQsyl1v5OG2bcUB8GSZR7#rztbTMQu}$
zsUdc_B)3s6%*FGK&QnaV%xmbMRU%qDTypYA4OT6xM3L0xQL7n~3qplHu1*$g4ApKM
zZ1XZd4G0OE(i*IRWC5_x$oGkPGc>Zg8IYk>`LDjVg$rqMiWbzvqx?TTkHh0;PhOTX
zJDq*l@HP2~#iM)ed(1DI8fiM|BKw?s4y5dA43v)4Y41fQsSB5=O2qiD5A3P}1)mU`
z7_G@v6lGde>Fo6wCwoQgHNj0JTM1unrQH5F<$bWseQCJz54h`Y6t-FDmQ|d*K)ft4
zq~~z2w{L|52wLPz1jG7<pW{XPABrYuaE_JER_<fa=sE2k<xM*!U?Z~WW!77fNsRoy
z`~-6*Gx4SQmm)sphvB?!AOfWG%gpm0Xwp`@0QlX;nJ%>PrVegsP+Z2BP*hbId4*wu
z{YYC4M1D!JnJpq7@_nS0k4Vf}0KNGer*{4s%OHHdT%+nlks};4E%>KaMLD|j+k%#0
zBHWb$BK}NG3>I*RKC$_I1Jb|!)lDP=nE~vkF~lehA*UeC*fIy~6nSG1vpb!Wl^d@-
zjRIfdO|^h7qj3U`e@GJSDB-{yBdK~MP(5e!3JFluKEtIF!pD*wZAgD9DG_&+L^u=m
zEcD1iX8`<if3Px`-}e#x(20hF18-tYj?et>NYdowF62W=ltfRPsdd~pG1(s;D^htx
zsVbNw`~)!rCq$~^lF!tMA`r!3u`5(7!Z74$Rtt*SlvU(!(h8DuWco4BUE+}yd00#$
z>8WCi=brF@mh;1vH;bPMUH?r&uV@@mlhx1#JFH^*7(>>xP0@S;eyV3Sxt>V7-7N~4
zCvn2LDJ#In%qoNP4V|yxjAb2*C_IFv0#B%oYQawbx}^Pn=DnC9?#ce+A|dXtR%iop
zGLUvpz)x9D>_+l{Yb;hW*>%a$53u%}Qj_|WFv|{OQ#*Oo9bW$n4{2Rraaj<y1F2A9
zSwXoe$4#fVf@bevR-^IsI%P_|wy-YctMP8c6uLK#iYZ3uUP5)*4H@K+$KD7aE;>K6
z;AiY=jns-z14kjCqZ)%}T+-A8w}L)RaO?ehdH%j9vDzH!XruqCbMgm`&Dv&LK`v}S
z?q4Qwza;Fm41@3lBQH;8u-7&TT8x@c<Jn<ji8wx{mpAN;wXxaKKJJSmsLF6PT|&CQ
z3;etu=i@niWi4=C&#?|LsmvUg(tX2VonQQl9t_cH8c7ct{YgU{bK9LkkBnoDw4<3G
zf2<COr^spj2z4$B<t6(e0S<`O9ETacOL3F67Q^%~!tvoanKhKOX)S4=#aK1Rc0?Ez
z_H&HrSwZlHQqn-3Xi3C)GR#tKDuP^QFuAly2YuPkouAi$WsN8*i$o$GMzW<^fdsh>
zxnmNG2i1h6w)bSWD|ItgzP&Ba%L(zyt|jntIDdo^ByKaaxyqkLo`r7NG*8CKC(dUC
z+9%<Tqe9eOX!~N|^9w%PK*qtWYh;NL!SHq5kNT-@kX5NU^GSgtzOS6WLOpXUYdg!{
z1>P+v>F!&Q<`u}U8q36GzI(;EE5*W;)?YLBVd5qe@6si&u{E(cs>qeb`c$Ov4^w6?
zNyjZr6oqchNz@;Mkq+f-71Ctcg5PpqdE%1wD6#|5^co;y=V_RZ0=UN=nS5T4VA;@>
zN(1t!oflVa2<bs!%B!ujBpOHh2M>uB;?rH`L<Y#It{O?X_{2j2s|#9dR`?q-TDIcE
z8#0*~2x}FqQC8Gal&4rZfs+Mc!^aPmv&l&=m%xr3lqP#2@Ozwhy|PSdb{}t4FxPx6
zqC67dw&b$fzDmZ=hh?OSFP!rKYL>MMdf4HQr&i2u@>u%2;Yklgs<^*&M;me!1U>#r
z5D7)|@=Pey&mn9gZzJO7cSCW@9q{yQ$ws0W>QsHnsIKpb_=~no=5$vTSu7Iwt$qt-
zR87C1d&O0Yy`t*RVAHkx%+0gr#v5&35Km;0tvP~x|58VidVL^z1<02J{&8QEwD(gQ
z<yXTcT$U5+=&%_hDcf13m)|ZcQJ`o#wPrx^8Pn1FjH#z9n@gQ*ZT``om0f*_1SurO
zMDg&jxyvq#y#0Ett9k^7-hcaJfG>QB4)Rwye@rYtix^Uh@ONwR2~8=Du`?wj&AHxn
z68(8b{DSZ><DWZxWEt8l&(qWF!n4mbe8Pc(Yd(3tme50JRhrewSxFWJ^=0zvF$VWv
zPuNk<b8iyUo$x8ivoUlLPC0mZ25wEi0;)xJ5IyO3SBiag+zSJge!yetf|n1Pioi3r
zl=n~^>>yIDJW)Lh^s#6dr?yWgZc<W|o#7?1;Afk1Osoax#LlfxFs3jt)M*Q5z#h;f
zRx$g+3cHtr9YE$Q*YjQq*$^Kc9foxoIL}4cu%TCZ&9Jw#lEX@ixbTx%7I=5`p$Jl#
zZg<iSpE*8ho=HbtgIL-ju4BztMqJ0aM1*f31rd88|B=yEB3}YE4}nMt_mmIUwZNuE
zwkp3?c=a!>?VDX!XJktZ?iq1o4+(7V!nTdOdg|Tqsl=LRg&XYgyxjC-9+Wpu+$lA>
z3*~r^x_$l)*bF4l;#{wBF)D>R19^0`o<e0rEv*Yf*o@;J^vMq$_Ys&striRUDXQ{U
zV@fyi!jQ=)f00$`qgBTmW`_O1S=<tyx*z<bDOF{h(Y8kaIJ^V*0x_N7!mSiI>@_|N
zG6_@ii;D1`$haybJuTs2<r-OfXT=9N$BYF@`jf#TZ$h9>?Ns9jsu*dSbzoR+EVn3Y
zO=#pi=!{`c#L%pjrcrWI1`qfjbY-GXjtkhzX<wAch}O_=wQ!7=#g*>HX(n}-n>HAW
z(@P0!Hcl|6>7tOe75@}KVk`pB8hl-Mc#t{oR%#K^y4jGe@foBuLzjmTv2aG2%t`HY
zQbfo!R(oO{3o6*=lE+{Uu0+YLu|wE;77LL7Ab6p0uXc`h$YA>GJ?qBzR0}I>(IIRX
zKU+G)-1py?Vm-k@M5%}+wn#Y72S$`7Pnr>%Rl)JcB#$@M>5$Sh$I~~$wK2Gpc<-GN
z<>mq5B`dbUZ{Rl@1df%@xUvm$GGRKYl@ISGp7V#+YrA#Loqj|CTD}5XRCJ;akwv<@
z#PW%IGFKl}ZcT5GHt7TVf5EG8x%M@dFAksJqa}6)F3Z@CdPQTN!IYAgv@S-oDgj0p
z40e+7rydHWtz54e)iRgSTIPB0aR1bE!RlqldiduRp$<j#SEaL#xCq!B6)whVJ)#By
zViS*J@wJse?2pt_x#ufL^E`MdC~oqo;-5IGV^sZ#0u|Nq_D|0BkCB*2b3Cean^JN&
zvT@u!>737h(OnIbQP;0bQk(W<9N>%A4IWIgRkp|#GT2CwD5DezSfsMs&$oEg_C-!C
z{)}szXgibNJ62a{k^?J8Z14%vql}Dlj?tU(FeUMa%=)Srt;Gw|nK8(?HiGF;Ft<a1
zmVtfevS(TBDG-+x(5oS!Hl?VBGZG^W<v163qpUM<#YdIsVsESyk6_u);k53-1`DT|
z%BOIqG)5>#qFNSb&x3I7|LwE!#!n3<gLhF;$E&V=UzA&i2uk{QGi>T1a#jq_UQS$G
z0<$B<dQz*xF*>Y&?shDbt*Ak@O6V}?7OJuE?3VS3$aV$mE9DZBQjlO4BKW87`%25$
z71rkCVlVPZQU8sM#%T`z%{3)Ju7S%Z=BsBa+_sxbcMJjc3nwCdXS|aiS3KWdPoq%y
zEfW<Ck9axJ^P=F8lRxW?Yq6b&0V&Iax5B&lh0#j_O<P7O8n3aUW%KcD7wQJqV!l$y
znE0HL7i92onmERu>T>+X7^ylZ?JqbK&CQ0GOOXutpY5?s`T1Das`Vr_WX^FFRlC1a
zOm`4{t^FrYAjh;$QC1MX_iPXKSJ&e{oOFuKK^mT<jtG?9&FZ^|vtm&U(wc&S>-L*d
z+hfJz*pLE-l}p!n;`=#$F^Q=ZT0Ia=2l&Dy6TTmX#=G-;zlqkX#{xJ*Gr);An$dAx
zPvrnFkH4f+L8)SS4&`IR<pR<^Ix8wwx31<;czb7HFPui8ZP%#>E_p9iOr679DZ%rg
zBDPF-qp79qWDR_5X#JqdUrx7<gSJ`g?DO&oHo!pS24{tbB0ekmjZ#zdxYkFaaM^BC
z9msZED)-zAN$a~RWplg(L18RUMaW^r%8CM#)a`8{PDUaJqntAHBzLygKXC02u+YNB
z2sPFZYxFcQmmcyPNo&Akrjy|}O1Qvn(+RUsQ16zyXy)9d!X_JFhL~bOf9j<c!Zy<|
zuBco=1SAW+4CsG6&LYg6cr3RzKEhR0w%M)<(3$Tlrswj9Qm?h6ccrepa2f<UytD{3
z=Df*e`ZUXP2-AdzTkI*HNZ@CLAvs%>13OTUIS^&qEtd6o@zN<Uaw<zc24QZKQxWwk
z=F1$Q)&rg<z_1OywON!g)*UNfL0GOwD&jer;wb2xJuN(uC4C7iqTyIEb&|&#oS#P`
zMc>+w=?O2ME%~&XZBJGOJ0?I?1?*ZQXB@r)5@ey}#O4O$Jmg4`3efN51fty2G}4F)
zeXp&c_W7sF+b=sjjI+!6Q7Ai=66>zhvbI|X0{+-_J4Tty;{ae~J?%f|EqmWzlG(3v
zx^7jekKiTtC5<>iWhPH35^lv=MwlCl@IMTTD$P~FDB(+5tvrY^lAOhdJ+m<NSDT%x
zvWrJAx)oG$y1pXWF0iZ_GNC7(WO8hwG1S(lqrr^lkK~nrliVx=ZEg2?iM_KV&|7y<
zEoW)0hNY=w=6F6%^-!|g-p+d+sbX*BS<dGmhKZ$jETqOi;IMI;d)A9z(J{2505b86
zV6n7u$^n8;9E3B>Zpb}(g`FF?;^n;1jUWZHd1>^|uto9XHAgc~EcZ5mHPd$ah!u65
zvjxoLJ&OL!6GyBK$zY9}vJ}QH%2zz%uf8Ok-90fy?-PO8Z3-(_n8gMmCzjw(bj)7w
zHKJqhc*(@kd5Wo=P~Um2n6tu}+)z9&L8QyIJZhTpj`qEK7ijfd)9q)YxBpfp+y3V=
zmTx(GNd}uNbxwA1<Oour(@zSJWr#eoC<O}i7lRy5Kbd&;fP>KHeVw3`DZJXG#l~`q
z%M1kmpP{jPaovpe16ai>cN~MrPErC->{sNm*ODysw3<j7wc9zu<trspJYS|F>`465
zE~+tO-SY6-xlG)@(gP_3ytNoHu$zGMc%6Z~r1cOAlLu@CUcreq3$-o+J!o4wvo(cZ
zczYk(99S)M&HEOKZ<W(AOGp+{#R77TK1x-Xp2#)EF}w4xlFuCFbldGpc)vxCiZa55
z%4g8}N$`&^*lWdFpo98g(!fasw0~Yd6uG;Q>p9y?0`8u{ykptGk~4^{FH(#tZ}&Vr
zAhL=5THxZh!tfk1n@@bneEc`YFW%zE>K~>jYj}thPf#C)l^vvxvbp0iT#W*S))dr<
zUjhk6^aADO%*%TU4cqaIqF#HH*F<N96<ju>jj?9&ltw-qJ7DytBAH@0#=&1#2Wqe2
zyl<%$8lAj%3x?8z4ua<C>D0Eq4UPFTM`GRP@)ekUHKrc>w7ZmkR&TfjB(bb`5e<B`
zE5;$fN*TPkUk`)poq4}D?sN2+{^2ke(^wQ~@wer2KXM$<7^<lL_=`V05PbD&XnM8d
z{93$z>`{E=9OPX~<hLzfMb7?s20WJby`Y>6v6{3fnC;~(u5M<mSq|?Fe~WlH3(Xg0
z9F~%sp{6l5+&3q=t1^)KP54tkeVKF$4fU!X$JU~ME}jBZw2ZSkxy;9lp<D|*m&wJj
zTaTftC-A={i5wi<7AS*07L#Kn;ye<Q^4kPGP0+SN1wjojN_-Ycj!7e{xYD#!XP1;s
zm9*X*wO%*8r>a&WMKct|5~V493%7k&B)T+Bo314mR(cxS_8_XQP9;rRO6~}l$9`!{
zYyK+lLn8JX*Eo?;a~jkRx3Dy&jAQ!52e@oe4_&D30-9Y{o-f$K_FOeM%JLJbJp>FS
zf@eG%)55I;sr(>14RtvtTlZMLCgflp0Tac330|KZ?{V_xRc^D)AHcXR;LaD>P@vU@
zx`zOT@<sJ4?7<#fiw9A7Yo%ZmxSa5rlNb&Z7pZy<>NLTxckJ@~3IIZr5kv)eUcIYd
zd-pj%(}Rlx*bWO5t`H5(NPDPKZPC>WP``O}VSk0+=u;=i*z*yv8+A*cH-%bW8*o;!
z$;#>gX%bK;6a2t+o`|#d{60+6B5qymYZ047m?RlkSw6U+n`T=?j~#tC!WD9MRq}bb
zgyoW$U6yOE;j+Rsk0nc8Cx0&k+XIq$>IE=g8}1;LK<OINKy@2m2vp{aMR|q|BCG?j
zWv8~Kp)9W#M}^B41-IIX?)*{2bPQ(h!p&@+SW=-5Y5dG1V_*fh2-aVHai71njeSdU
zld?`DSA;AxhY}l*LR(Rx1|umqj}&QqtU;jTeJC^BYgAd|M<wEaG@W-0O3bxddG9%L
z%EbcVKtSq>z)rk{(I==d>9}eO&PBi5!clDiF983DFTsv81H{Qi$`eSkVp9Ihq}lZh
z`Iiz}_fN0+=gWFkAuUe-38~PW$Cxi$#Mnzl#qo$|!v0b?S>D_k$h1ow7#NXwT3!Gw
z3)P$G{tGdy$e!BSg0PR9TU--(teYxTp|h5AELSm(c2Y7=mpnW|CMwNjveC>v&#|s^
zpp=<;oD=4lWUw4xHc|N;+gq^$t{ka2Bf2+64H(<t3NcRgKKY+9_Y0XVZ8Bo8>{THi
zWacC$U1=jPNw^R+BfeR3ZN2kIU1QgjrUU}Vf|&WK(OG7^pwC5v0&m219>z+ymjmHa
zv^Vi|d{6gYO6r^`AslF)i>!GeDYrTkd^CEeJ@aDZ{AqS~wTf_wz$C)u`6s=buMmx*
zDnGXzM#>1F9JQuk<YouCQAX;GgjO#NP!L|BummXQB^C`A@H)-(d$ETihefb*R=YDz
z);i1PT}eX4osl9!_%Non%woQuq^%VbEL&8CX3syPOtf;mya~Fqo@I|S2S=A&EM<RE
zgYGH~+w`&74)C==YVD=vh{d`de5$Yzy3~m#`kZJqnS|0jB^ViFNE{?a1!SqGWpmJc
zf2M8DZeuxcwEkAH7OA~GL>T0%qU;8vxkaUdHj74U@mrprY&6BOu%xui`Dk>aaP-Ed
zX30zOi&AqV>CjQ@`YBN6`=%)Q2^PSCXUvkq9uv33(UjX|#J!+Ink))ORUG?)>%*|M
zs0qzYEdyH^d4Ce_dQMGvikk)`b7tyqs)IFdKGON<{ac30YBEmlFs<lOlU){X5ZnEz
z#o|HSv>`dE8-JptVK$0GOHfGoTTmt#zi(F<5UUaJqpRB5+^oAyz7afkW+NmaJ37o$
zE&V(chFV>GC0?vDwM{-V6x}B5f1Z;m`BUt!9Y+)=EaxTk;V4Ze?mAUlsF_#=!TTG!
z$g5>>%&FG6J*5sH_tMAnd#jurfo~DLB5($eNL}}Qxk{v#vkN%T#88_1d=wDo%BeUe
z#S2u>)0wYUnu{I)&pz8EACuyR5F-o%16B2cf0=nGH?S~oS~$7XLgnK_S}e(NSuBD3
z40q3l>dR?OmrR94bvF^bi0@2(l=C027&z5WMwQSa=xjFN4cIS9sh6)_e(A;fiIY?W
znL`;bbB|+kA~!)r78xDe`hlkJz89?mAIkH|g&v4|RleZxhpnU=8I2gsw5Oy7G=r*b
zV0o}X|E=!6Ii^VVgzoiqEs4sQi<yb{G?^w45970N_WKGlrY$ATHP~hsYGL(WgF~4v
zh~$@N;L>Xqm#Gou4A@_A)@UNRA?=xfiofwt=V6O22KB@h)8CEASf)O-&U{iF#5--`
zU3ku<%^~o9*`GU;eD7MOSl+r%{o()`O#E_B$l{h9b1(%=jm(87^a7GMzO4-TjB?|q
zMf@ei(-W09oW@*rAeW$#7$)RP1UQjaPh=9N2U^l8`wpkg^Kj43B9pc=2=w*^*)YeL
zjO_7p)-mkg<Cu(hPSls>aT?fcn00*U<53wdyOkd(=o`-)JN<%#Naq~XkR6M-rgGwp
z1M|3=5wzm8<pQNF=~6lgAV{Cn*VsqbesIv<2H?ezDxuP|ILq5Z!dYV}^eHI3dzo2N
zCD?vt6SZx}-Jr)0%a^2aIGg0iB92AN2qH1<rRQMqmVI-O-o;i_B2V5xvHvFL%F1aN
z;A!|CMiwrTJ=$KSW&nlpU(upV%G4h8eH;;Udiqd3SK-k|uo1ATc7h_GOHuI`ns761
z#Av(OKYLOoO@Dg75W-cipk0Jj9P*?>;}$UKLT%hR3^M7{64sQ57`Q>V_T=`oQ!vjN
zgoyPu(m@e`4!nx|T=Hq@Km6U3#Gbq76WcKeuzyn@gg7J<l5h4b7ekr!sMLVhb9J!y
z`N#QA5)8}vMC_qKzM+MQxTKf)LbaeF$N*ZaiZ*B*KC8Q&2yN6BGpYq7sYe$O_1ETW
z*bfir&+inksKdTb@LkR+jH@G1;9(l!Ox|xqMrbG7ysvqtLH;98#l~yxqHHuT9UGU{
ze1@jk=Tz3(C_o7IK>JZQ+^0X1gxqO4f@|p|GqXFBwI2b4Rk7IqkmiHX;TyR$ZwSm%
zUpRby3Vu#;+X~Aazo_m(QX1Vo8X&f>I#&jkbh7*pp~{!pAz6-5t+l2r**HHW<a<8g
z(C{&r!g`ZdmxTdh=B})&8LkB_^$CoAK3Fkp(7DgGl`*Dqlb>n3h3{Kru;x^lvBZRf
z&4JOpRs;nt?g;<JuMNT5s)kLUYzxucMmC$S_eW?cmwlgNieSiQ{TQ)$czUQU_vH*%
zYfY%WPNpjn&a~DvC`mt>s0<wiC`B23F~XL9mv?aS?*1YZn5C3Y@!wV-&}AK4Q@azN
z-W7{7QdHN562UPF3NZ9IXdh-w+Sql+e7xe^z5kKzp*}`Cr?M7C>*=t{q}%v7BDNQ6
zBvQ5}{)>vRRnZU{OsZfLiav0P3pd(5a~=O?<`GlYs~^b2oql25RDR{YOhS)X5h*@a
z)Ny#`TUK-)yU6(sDjys8X?<78t#{lzUTlNNDDO`;8@jEwZ3QZcq6n?M<f-D`CJ*0O
z*vYpuKUQVF7_}`&&L_^$`{^fnExT1UJ7flPc4yi4C_l}QAXlujHI}3J;aqduZIb9%
zC(T(+yB*^riq9QRc8&|VvNJ45TXH}VOBm;&`E*ndqBv`r^yj)PHJbc@?;T1UQX8aa
zUKhd~pu_K>3aExy1BqA+jv6)MRt|qGgGqlVS-mw`OLy@Dbg70nE)dUilH?&8uXm<r
zAy8?G+aPnoTKl6Q)X`Ypz5sd+Z=D(RrN(zFn@gqj1qr?Y=gKoWRHM=F!Uzfs0*5KO
ziu%&I-Sa$BuryW2x5wIS#Hi4K`!_5SKgMM!-S6N~y`#cF?Pl-ZGa!gyuY5%n^=K5B
zCSKVg%x)K}9)o<qt2vL?mZ3avq<r%c2B-Kf>$eJ!S#T#Ha?HUgKNC<-q%sV%NU2dD
zcC`4elB1O!YM!K;z7jd}+&FAvX=40F_zYJ|F^e3upeAk*i9`5SnKB>81bT>VLm06(
z1pnb9&KSU_HOI!1hhT;vUrvL=TrsXwlGSARX7V{RI<KH;%!HWbE5ULrI$RpT?(!6u
z+D42uQk(oUH7#V3j;UDCPWbS+>t=LlgDH#(Ze)hLEb)-$9DV?4?ZY`cuxLouAht)R
zkQV8QTqVG~R0LuLAt)8fS*oZq&*NeOM7y%!t-|P$GRi}x78*y29FW*%-iSZ30I@(M
zS^r3Np!~~1B!7t|{RJ)b!1G=U;@WnKw;NMk0_pm29v-Ur$i)AP6P?$o4Akoj(y@aA
zfyDSctzorM51eg~EGiq`%2PMJA;GLHZicmDyeo9HcI6_!>IpVhHkc$>6idgKbCwW!
z40#?O2Xeti!#`=i+^-m4<bZXprC74pm~TR8TqE6PqK^BhC^CGCXHEE^jVhjuHA$o?
zFRk5@!#OkoXj2GbI_(ijRplRvrK-~OcmVL>$~(@tnWCombsoQF5!r3#af0V@AZr)%
zN!^J94jSZ0sU3+N%Z21<ueV`{Y8vA|SM~jeQfA2W6(tG%D;yryA>ynR_Q!Lc`Dwmq
zld>e(gP5gpEb7BstKc~j7pAEtZM=v;W;-yZG+t3??qw0Oe;wW@4Y-NE8NLngPv?~=
zC2JFGIcvsBF`T`U$zs`tHP0jZjmr)|(SMh71dYi#E&}1{J8j8wB}sxW?35xcki$x3
zRB#=UQ}6;aq^CDoLgjH!+RA-U;hh_)am*Se;S|O!zdFStMVs}IGb^<tO~ssZiMjX{
zP@5Jd!$q3XJ~)e(lcNpvpGTIJd8~Zl6(@EzqMysC8pY8ZmCouUk;^fTDt`>5i~E)D
ze{-rP&(CpQbjC`k6Q46*AN+fOBx7O&8kpAvlGE$tZRNw@@|1>wUm8%*@x>!b`5`xo
zMMMae>t2T&o$D^z%z}(O^RMIM1F(ibl%?srIUSPz;*H@F;~(D}W_jDV*x{;3pE6Y<
zKMD#6V7ExoKkcIPw0oecl9_1@%TU!MMY;QOJ4xr<7Hj03RxPKI-2|?O@jvwZ6=%ul
zzL$t9CwhV<=9g}aXrqcVj*+tPU2!F(><o0z7->GC230L>$*L>+!!~3ImClUJ6m2HB
z$5O7{3}cdePXicjR$!33fDw2tQc@My&S$gNH|zF13UFtfy%-N2`fNS*Sq1BN3~2c`
z%4K0Gm!&jIm6{h^pt7Ugf%TxC^9~5^X&u<$U_<r-3&)nKFY<r<2+<3aA>cK^R@t^^
z;S~orDVhqg1hc{WolaZ@iH1$Y%>;dA5*w@sb)Wt8__ySAZ~Kr^C0X|a@48WOl_EZl
zzeaA>u_I!&5t{Ls$)~$5iIr6Wx0RM1IKmzP=74v3=n9=lf4;Z*Nx(2Sd}l&|X52OM
znJ50-a|aPsF~6jY0NL;h4;xAz4S=xM<ZdRvWRK^W*y>7AiUd{@fpI*>X!6)OwVOgs
zjhkol>qRrmw!VhY5*Mu>VI`-r)b}>Iw~Wm%v+ZzPAH;z=%#gB)Fhp63@qq{FYP0D7
z%Nl5*`DP#Q4Fu^+I9SYtx?i6;tLShcNbwKlIs2q&SzfeIRN;b4X`cLJYa5_<;iW6o
zl36jK5F7QoR+~6R=;vhjAVNds&?bMo(Tq<@*Vs7sx-jZRV-dR3aebzR%c)8#gmFou
zAO-o>`UZQ9Dkfe6W$;m*M{tqNSpnaxkh!=(wWleRoHhAK8i{XH`&M;CyEeXVf1fu$
zs*(>|%tTQf7@`6E(cuQwN67zqw&4zGiKRP7M1W#NrtL}b?qx%eVOISO1b9nk6u)3b
z!~qLw7A}!hP}t`QgK)3_d8-tO1>+>PoIf9XX`cyCybpg;pCv`$63aec=Uc+dyV{!*
zuHp+#Kg4ar^`csF%k{0Y7<>~5`AJD3S{`*qFCl#Of#pn<?bJIDby_QUYN*1`rGckV
zboi5MJL}C~-JUQlbzpR!wIYEVu~oEceF`eK|2OMqDPa|ybkR*`6DOtswWLVdYzW}n
zX8wJGre8}(fJ~#@Tcn2?2aR^JUHN0;eGK5HDG62Urz`@Z28jRNK^D*+ld3O9|0a~J
zlifbMtMw4+U<qnDGPmo%>{uKWl1CRc5Gw_<KSkue^++x=g6-|DCiO!Fv<aFrR+H3!
zSnrROLO=G_GctfxHAcMqHr<%Vh^49Nyu4S~NRbQ9%Mf?$In``q?PSeM!^7=wIpxp&
z9H_=Sh8-1N-3w5q>4p!H88(xd3=#<@z-8AKMkHg#WefiCjs`&_mF+>z1#EHM^k$?v
zeV^`no%(-O|2+Hu^!{G*|DN`L^#3^j8qe16_Wyi6e*Wjq{eIt{KlAy2@9O)1_vie-
z-@h;CZuS3D>EEaM`v0l)|66wb4{y`IzLWa(A6}(@{3dqk-#<zH`;Y!VhrhdhM_>9%
Z!w3}JJ3v7A{|~Rn1_J#*+Wvpj{{V0V$kPA-

literal 0
HcmV?d00001

diff --git a/packages/apollo-collaboration-server/test/data/volvox.fa.gz.fai b/packages/apollo-collaboration-server/test/data/volvox.fa.gz.fai
new file mode 100644
index 000000000..a42fcf670
--- /dev/null
+++ b/packages/apollo-collaboration-server/test/data/volvox.fa.gz.fai
@@ -0,0 +1,2 @@
+ctgA	50001	22	60	61
+ctgB	6079	50879	100	101
diff --git a/packages/apollo-collaboration-server/test/data/volvox.fa.gz.gzi b/packages/apollo-collaboration-server/test/data/volvox.fa.gz.gzi
new file mode 100644
index 0000000000000000000000000000000000000000..1b1cb4d44c57c2d7a5122870fa6ac3e62ff7e94e
GIT binary patch
literal 8
KcmZQzfB*mh2mk>9

literal 0
HcmV?d00001

diff --git a/yarn.lock b/yarn.lock
index 8b631e52a..ae9e89930 100644
--- a/yarn.lock
+++ b/yarn.lock
@@ -428,6 +428,7 @@ __metadata:
     rimraf: "npm:^3.0.2"
     rxjs: "npm:^7.4.0"
     sanitize-filename: "npm:^1.6.3"
+    serve: "npm:^14.0.1"
     socket.io: "npm:^4.5.3"
     source-map-support: "npm:^0.5.20"
     stream-concat: "npm:^1.0.0"

From 83c14094f51c8d3430b54d97e8902d9072527a93 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 21 Oct 2024 22:35:36 +0000
Subject: [PATCH 05/10] bug: keep file from being unzipped multiple times

---
 .../src/files/filesUtil.ts                    | 30 ++++++-------------
 1 file changed, 9 insertions(+), 21 deletions(-)

diff --git a/packages/apollo-collaboration-server/src/files/filesUtil.ts b/packages/apollo-collaboration-server/src/files/filesUtil.ts
index 79bf1d51e..31c6f416e 100644
--- a/packages/apollo-collaboration-server/src/files/filesUtil.ts
+++ b/packages/apollo-collaboration-server/src/files/filesUtil.ts
@@ -99,29 +99,17 @@ async function unzip(input: FileHandle): Promise<Buffer> {
 }
 
 export class LocalFileGzip implements GenericFilehandle {
-  private fileHandle: Promise<FileHandle> | undefined
-  private contents: Promise<Buffer> | undefined
+  private fileHandle: Promise<FileHandle>
+  private contents: Promise<Buffer>
   private filename: string
   private opts: FilehandleOptions
 
   public constructor(source: string, opts: FilehandleOptions = {}) {
     this.filename = source
     this.opts = opts
-  }
-
-  private getFileHandle(): Promise<FileHandle> {
-    if (!this.fileHandle) {
-      this.fileHandle = open(this.filename)
-    }
-    return this.fileHandle
-  }
-
-  private async getContents(): Promise<Buffer> {
-    if (!this.contents) {
-      const fileHandle = await this.getFileHandle()
-      this.contents = unzip(fileHandle)
-    }
-    return this.contents
+    const fhPromise = open(source)
+    this.fileHandle = fhPromise
+    this.contents = fhPromise.then((fh) => unzip(fh))
   }
 
   public async read(
@@ -130,7 +118,7 @@ export class LocalFileGzip implements GenericFilehandle {
     length: number,
     position = 0,
   ): Promise<{ bytesRead: number; buffer: Buffer }> {
-    const unzippedContents = await this.getContents()
+    const unzippedContents = await this.contents
     const bytesRead = unzippedContents.copy(
       buffer,
       position,
@@ -154,7 +142,7 @@ export class LocalFileGzip implements GenericFilehandle {
   public async readFile(
     _options?: FilehandleOptions | BufferEncoding,
   ): Promise<Buffer | string> {
-    const unzippedContents = await this.getContents()
+    const unzippedContents = await this.contents
     if (this.opts.encoding) {
       return unzippedContents.toString(this.opts.encoding)
     }
@@ -163,12 +151,12 @@ export class LocalFileGzip implements GenericFilehandle {
 
   // todo memoize
   public async stat(): Promise<Stats> {
-    const contents = await this.getContents()
+    const contents = await this.contents
     return { size: contents.length }
   }
 
   public async close(): Promise<void> {
-    const fh = await this.getFileHandle()
+    const fh = await this.fileHandle
     return fh.close()
   }
 }

From 144fef97d18506a95fb7ccd8cf3cb0da871c1656 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 21 Oct 2024 22:34:53 +0000
Subject: [PATCH 06/10] Add default checks to assembly when it is created

---
 .../src/changes/changes.module.ts              |  2 ++
 .../src/changes/changes.service.ts             |  5 +++++
 .../src/checks/checks.module.ts                |  2 +-
 .../src/operations/operations.module.ts        |  2 ++
 .../src/operations/operations.service.ts       |  6 ++++++
 packages/apollo-common/src/Operation.ts        |  2 ++
 .../AddAssemblyAndFeaturesFromFileChange.ts    |  7 +++++--
 .../Changes/AddAssemblyFromExternalChange.ts   |  5 ++++-
 .../src/Changes/AddAssemblyFromFileChange.ts   | 18 +++++++++++++++---
 9 files changed, 42 insertions(+), 7 deletions(-)

diff --git a/packages/apollo-collaboration-server/src/changes/changes.module.ts b/packages/apollo-collaboration-server/src/changes/changes.module.ts
index bf8612080..55889d3bb 100644
--- a/packages/apollo-collaboration-server/src/changes/changes.module.ts
+++ b/packages/apollo-collaboration-server/src/changes/changes.module.ts
@@ -6,6 +6,7 @@ import idValidator from 'mongoose-id-validator'
 
 import { AssembliesModule } from '../assemblies/assemblies.module'
 import { CountersModule } from '../counters/counters.module'
+import { ChecksModule } from '../checks/checks.module'
 import { FeaturesModule } from '../features/features.module'
 import { FilesModule } from '../files/files.module'
 import { JBrowseModule } from '../jbrowse/jbrowse.module'
@@ -37,6 +38,7 @@ import { ChangesService } from './changes.service'
     FilesModule,
     UsersModule,
     CountersModule,
+    ChecksModule,
     MessagesModule,
     JBrowseModule,
   ],
diff --git a/packages/apollo-collaboration-server/src/changes/changes.service.ts b/packages/apollo-collaboration-server/src/changes/changes.service.ts
index 71b9704e9..bb2b003ed 100644
--- a/packages/apollo-collaboration-server/src/changes/changes.service.ts
+++ b/packages/apollo-collaboration-server/src/changes/changes.service.ts
@@ -9,6 +9,8 @@ import {
   AssemblyDocument,
   Change,
   ChangeDocument,
+  Check,
+  CheckDocument,
   Feature,
   FeatureDocument,
   File,
@@ -68,6 +70,8 @@ export class ChangesService {
     private readonly jbrowseConfigModel: Model<JBrowseConfigDocument>,
     @InjectModel(Change.name)
     private readonly changeModel: Model<ChangeDocument>,
+    @InjectModel(Check.name)
+    private readonly checkModel: Model<CheckDocument>,
     private readonly filesService: FilesService,
     private readonly countersService: CountersService,
     private readonly pluginsService: PluginsService,
@@ -123,6 +127,7 @@ export class ChangesService {
           fileModel: this.fileModel,
           userModel: this.userModel,
           jbrowseConfigModel: this.jbrowseConfigModel,
+          checkModel: this.checkModel,
           session,
           filesService: this.filesService,
           counterService: this.countersService,
diff --git a/packages/apollo-collaboration-server/src/checks/checks.module.ts b/packages/apollo-collaboration-server/src/checks/checks.module.ts
index b2854844f..a083f817d 100644
--- a/packages/apollo-collaboration-server/src/checks/checks.module.ts
+++ b/packages/apollo-collaboration-server/src/checks/checks.module.ts
@@ -97,7 +97,7 @@ import { SequenceModule } from '../sequence/sequence.module'
     ]),
   ],
 
-  exports: [ChecksService],
+  exports: [ChecksService, MongooseModule],
   controllers: [ChecksController],
 })
 export class ChecksModule {}
diff --git a/packages/apollo-collaboration-server/src/operations/operations.module.ts b/packages/apollo-collaboration-server/src/operations/operations.module.ts
index af2ea63ad..3385f00ca 100644
--- a/packages/apollo-collaboration-server/src/operations/operations.module.ts
+++ b/packages/apollo-collaboration-server/src/operations/operations.module.ts
@@ -1,6 +1,7 @@
 import { Module, forwardRef } from '@nestjs/common'
 
 import { AssembliesModule } from '../assemblies/assemblies.module'
+import { ChecksModule } from '../checks/checks.module'
 import { CountersModule } from '../counters/counters.module'
 import { FeaturesModule } from '../features/features.module'
 import { FilesModule } from '../files/files.module'
@@ -22,6 +23,7 @@ import { OperationsService } from './operations.service'
     CountersModule,
     MessagesModule,
     JBrowseModule,
+    ChecksModule,
   ],
   providers: [OperationsService],
   exports: [OperationsService],
diff --git a/packages/apollo-collaboration-server/src/operations/operations.service.ts b/packages/apollo-collaboration-server/src/operations/operations.service.ts
index f7604b693..0efeb1f2b 100644
--- a/packages/apollo-collaboration-server/src/operations/operations.service.ts
+++ b/packages/apollo-collaboration-server/src/operations/operations.service.ts
@@ -2,6 +2,8 @@ import { Operation, operationRegistry } from '@apollo-annotation/common'
 import {
   Assembly,
   AssemblyDocument,
+  Check,
+  CheckDocument,
   Feature,
   FeatureDocument,
   File,
@@ -40,6 +42,8 @@ export class OperationsService {
     private readonly refSeqModel: Model<RefSeqDocument>,
     @InjectModel(RefSeqChunk.name)
     private readonly refSeqChunkModel: Model<RefSeqChunkDocument>,
+    @InjectModel(Check.name)
+    private readonly checkModel: Model<CheckDocument>,
     private readonly filesService: FilesService,
     private readonly countersService: CountersService,
     private readonly pluginsService: PluginsService,
@@ -53,6 +57,7 @@ export class OperationsService {
   ): Promise<ReturnType<T['executeOnServer']>> {
     const {
       assemblyModel,
+      checkModel,
       connection,
       countersService,
       featureModel,
@@ -79,6 +84,7 @@ export class OperationsService {
       fileModel,
       userModel,
       jbrowseConfigModel,
+      checkModel,
       session,
       filesService,
       counterService: countersService,
diff --git a/packages/apollo-common/src/Operation.ts b/packages/apollo-common/src/Operation.ts
index 6a42a63ad..ea8dba2aa 100644
--- a/packages/apollo-common/src/Operation.ts
+++ b/packages/apollo-common/src/Operation.ts
@@ -12,6 +12,7 @@ import {
   RefSeqDocument,
   JBrowseConfigDocument,
   UserDocument,
+  CheckDocument,
 } from '@apollo-annotation/schemas'
 import type { LoggerService } from '@nestjs/common'
 import type { ClientSession, Model } from 'mongoose'
@@ -36,6 +37,7 @@ export interface ServerDataStore {
   assemblyModel: Model<AssemblyDocument>
   refSeqModel: Model<RefSeqDocument>
   refSeqChunkModel: Model<RefSeqChunkDocument>
+  checkModel: Model<CheckDocument>
   fileModel: Model<FileDocument>
   userModel: Model<UserDocument>
   jbrowseConfigModel: Model<JBrowseConfigDocument>
diff --git a/packages/apollo-shared/src/Changes/AddAssemblyAndFeaturesFromFileChange.ts b/packages/apollo-shared/src/Changes/AddAssemblyAndFeaturesFromFileChange.ts
index 9ac764cf0..3f08a57f0 100644
--- a/packages/apollo-shared/src/Changes/AddAssemblyAndFeaturesFromFileChange.ts
+++ b/packages/apollo-shared/src/Changes/AddAssemblyAndFeaturesFromFileChange.ts
@@ -65,7 +65,7 @@ export class AddAssemblyAndFeaturesFromFileChange extends FromFileBaseChange {
    * @returns
    */
   async executeOnServer(backend: ServerDataStore) {
-    const { assemblyModel, fileModel, filesService, user } = backend
+    const { assemblyModel, checkModel, fileModel, filesService, user } = backend
     const { assembly, changes, logger } = this
     for (const change of changes) {
       const { assemblyName, fileIds } = change
@@ -89,9 +89,12 @@ export class AddAssemblyAndFeaturesFromFileChange extends FromFileBaseChange {
       if (assemblyDoc) {
         throw new Error(`Assembly "${assemblyName}" already exists`)
       }
+      // get checks
+      const checkDocs = await checkModel.find({ default: true }).exec()
+      const checks = checkDocs.map((checkDoc) => checkDoc._id.toHexString())
       // Add assembly
       const [newAssemblyDoc] = await assemblyModel.create([
-        { _id: assembly, name: assemblyName, user, status: -1, fileId },
+        { _id: assembly, name: assemblyName, user, status: -1, fileId, checks },
       ])
       logger.debug?.(
         `Added new assembly "${assemblyName}", docId "${newAssemblyDoc._id.toHexString()}"`,
diff --git a/packages/apollo-shared/src/Changes/AddAssemblyFromExternalChange.ts b/packages/apollo-shared/src/Changes/AddAssemblyFromExternalChange.ts
index 913d821ba..b311f7da8 100644
--- a/packages/apollo-shared/src/Changes/AddAssemblyFromExternalChange.ts
+++ b/packages/apollo-shared/src/Changes/AddAssemblyFromExternalChange.ts
@@ -67,7 +67,7 @@ export class AddAssemblyFromExternalChange extends AssemblySpecificChange {
    * @returns
    */
   async executeOnServer(backend: ServerDataStore) {
-    const { assemblyModel, refSeqModel, user } = backend
+    const { assemblyModel, checkModel, refSeqModel, user } = backend
     const { assembly, changes, logger } = this
     const { CHUNK_SIZE } = process.env
     const customChunkSize = CHUNK_SIZE && Number(CHUNK_SIZE)
@@ -97,6 +97,8 @@ export class AddAssemblyFromExternalChange extends AssemblySpecificChange {
       if (assemblyDoc) {
         throw new Error(`Assembly "${assemblyName}" already exists`)
       }
+      const checkDocs = await checkModel.find({ default: true }).exec()
+      const checks = checkDocs.map((checkDoc) => checkDoc._id.toHexString())
       const [newAssemblyDoc] = await assemblyModel.create([
         {
           _id: assembly,
@@ -104,6 +106,7 @@ export class AddAssemblyFromExternalChange extends AssemblySpecificChange {
           user,
           status: -1,
           externalLocation,
+          checks,
         },
       ])
       logger.debug?.(
diff --git a/packages/apollo-shared/src/Changes/AddAssemblyFromFileChange.ts b/packages/apollo-shared/src/Changes/AddAssemblyFromFileChange.ts
index 8a9636494..50b5ebed6 100644
--- a/packages/apollo-shared/src/Changes/AddAssemblyFromFileChange.ts
+++ b/packages/apollo-shared/src/Changes/AddAssemblyFromFileChange.ts
@@ -88,8 +88,14 @@ export class AddAssemblyFromFileChange extends FromFileBaseChange {
     }
 
     const { fa, fai, gzi } = fileIds
-    const { assemblyModel, fileModel, filesService, refSeqModel, user } =
-      backend
+    const {
+      assemblyModel,
+      checkModel,
+      fileModel,
+      filesService,
+      refSeqModel,
+      user,
+    } = backend
 
     const faDoc = await fileModel.findById(fa)
     const faChecksum = faDoc?.checksum
@@ -122,6 +128,8 @@ export class AddAssemblyFromFileChange extends FromFileBaseChange {
     if (assemblyDoc) {
       throw new Error(`Assembly "${assemblyName}" already exists`)
     }
+    const checkDocs = await checkModel.find({ default: true }).exec()
+    const checks = checkDocs.map((checkDoc) => checkDoc._id.toHexString())
     const [newAssemblyDoc] = await assemblyModel.create([
       {
         _id: this.assembly,
@@ -129,6 +137,7 @@ export class AddAssemblyFromFileChange extends FromFileBaseChange {
         user,
         status: -1,
         fileIds,
+        checks,
       },
     ])
     this.logger.debug?.(
@@ -157,7 +166,7 @@ export class AddAssemblyFromFileChange extends FromFileBaseChange {
     assemblyName: string,
     fileId: string,
   ) {
-    const { assemblyModel, fileModel, user } = backend
+    const { assemblyModel, checkModel, fileModel, user } = backend
     // Get file checksum
     const fileDoc = await fileModel.findById(fileId).exec()
     if (!fileDoc) {
@@ -172,6 +181,8 @@ export class AddAssemblyFromFileChange extends FromFileBaseChange {
     if (assemblyDoc) {
       throw new Error(`Assembly "${assemblyName}" already exists`)
     }
+    const checkDocs = await checkModel.find({ default: true }).exec()
+    const checks = checkDocs.map((checkDoc) => checkDoc._id.toHexString())
     // Add assembly
     const [newAssemblyDoc] = await assemblyModel.create([
       {
@@ -180,6 +191,7 @@ export class AddAssemblyFromFileChange extends FromFileBaseChange {
         user,
         status: -1,
         fileIds: { fa: fileId },
+        checks,
       },
     ])
     this.logger.debug?.(

From d0cef732844ee4280127a74e9a1a7509d0eead87 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 21 Oct 2024 22:36:44 +0000
Subject: [PATCH 07/10] Fix dev env ontology location

---
 packages/apollo-collaboration-server/.development.env | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/packages/apollo-collaboration-server/.development.env b/packages/apollo-collaboration-server/.development.env
index 76a4040e9..4a7461026 100644
--- a/packages/apollo-collaboration-server/.development.env
+++ b/packages/apollo-collaboration-server/.development.env
@@ -57,7 +57,7 @@ DESCRIPTION=A server for Apollo development purposes
 # URL (relative or absolute) of the Apollo JBrowse plugin.
 # Defaults to relative URL 'apollo.js'
 PLUGIN_LOCATION=http://localhost:9000/dist/jbrowse-plugin-apollo.umd.development.js
-FEATURE_TYPE_ONTOLOGY_LOCATION=test_data/so-v3.1.json
+FEATURE_TYPE_ONTOLOGY_LOCATION=http://localhost:9000/test_data/so-v3.1.json
 
 # Application port, defaults to 3999
 # PORT=3999

From fd0a92f11074ad733938eeda4b6a410649c46554 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 21 Oct 2024 22:46:13 +0000
Subject: [PATCH 08/10] Remove unused import

---
 packages/apollo-cli/src/commands/assembly/add-from-fasta.ts | 1 -
 1 file changed, 1 deletion(-)

diff --git a/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts b/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts
index f484cb857..1b9b9b318 100644
--- a/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts
+++ b/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts
@@ -8,7 +8,6 @@ import { FileCommand } from '../../fileCommand.js'
 import { queryApollo, submitAssembly } from '../../utils.js'
 import { Response } from 'undici'
 import {
-  SerializedAddAssemblyAndFeaturesFromFileChange,
   SerializedAddAssemblyFromExternalChange,
   SerializedAddAssemblyFromFileChange,
 } from '@apollo-annotation/shared'

From ff9b0934b7df734755df890f303cecf288804cc1 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 21 Oct 2024 23:31:46 +0000
Subject: [PATCH 09/10] Set assembly status to 0 so feature checks work

---
 .../src/changes/changes.service.ts                          | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/packages/apollo-collaboration-server/src/changes/changes.service.ts b/packages/apollo-collaboration-server/src/changes/changes.service.ts
index bb2b003ed..7385fc3ad 100644
--- a/packages/apollo-collaboration-server/src/changes/changes.service.ts
+++ b/packages/apollo-collaboration-server/src/changes/changes.service.ts
@@ -181,15 +181,15 @@ export class ChangesService {
         )
         try {
           // We cannot use Mongo 'session' / transaction here because Mongo has 16 MB limit for transaction
-          await this.refSeqChunkModel.updateMany(
+          await this.assemblyModel.updateMany(
             { $and: [{ status: -1, user: uniqUserId }] },
             { $set: { status: 0 } },
           )
-          await this.featureModel.updateMany(
+          await this.refSeqChunkModel.updateMany(
             { $and: [{ status: -1, user: uniqUserId }] },
             { $set: { status: 0 } },
           )
-          await this.assemblyModel.updateMany(
+          await this.featureModel.updateMany(
             { $and: [{ status: -1, user: uniqUserId }] },
             { $set: { status: 0 } },
           )

From d210dcf4bc0ca540ad8bd7c602e09272be61ac38 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 22 Oct 2024 03:24:28 +0000
Subject: [PATCH 10/10] Fix CLI tests

---
 packages/apollo-cli/README.md                 | 1088 +++++++++++++++++
 .../src/commands/assembly/add-from-gff.ts     |   32 +-
 packages/apollo-cli/src/utils.ts              |    8 +-
 packages/apollo-cli/test/test.py              |  150 +--
 packages/website/docs/cli/assembly.md         |   15 +-
 5 files changed, 1177 insertions(+), 116 deletions(-)

diff --git a/packages/apollo-cli/README.md b/packages/apollo-cli/README.md
index bd1ca6fc6..b0faa1f00 100644
--- a/packages/apollo-cli/README.md
+++ b/packages/apollo-cli/README.md
@@ -29,7 +29,850 @@ USAGE
 
 <!-- commands -->
 
+- [`apollo assembly add-from-fasta INPUT`](#apollo-assembly-add-from-fasta-input)
+- [`apollo assembly add-from-gff INPUT-FILE`](#apollo-assembly-add-from-gff-input-file)
+- [`apollo assembly check`](#apollo-assembly-check)
+- [`apollo assembly delete`](#apollo-assembly-delete)
+- [`apollo assembly get`](#apollo-assembly-get)
+- [`apollo assembly sequence`](#apollo-assembly-sequence)
+- [`apollo change get`](#apollo-change-get)
+- [`apollo config [KEY] [VALUE]`](#apollo-config-key-value)
+- [`apollo feature add-child`](#apollo-feature-add-child)
+- [`apollo feature check`](#apollo-feature-check)
+- [`apollo feature copy`](#apollo-feature-copy)
+- [`apollo feature delete`](#apollo-feature-delete)
+- [`apollo feature edit`](#apollo-feature-edit)
+- [`apollo feature edit-attribute`](#apollo-feature-edit-attribute)
+- [`apollo feature edit-coords`](#apollo-feature-edit-coords)
+- [`apollo feature edit-type`](#apollo-feature-edit-type)
+- [`apollo feature get`](#apollo-feature-get)
+- [`apollo feature get-id`](#apollo-feature-get-id)
+- [`apollo feature import INPUT-FILE`](#apollo-feature-import-input-file)
+- [`apollo feature search`](#apollo-feature-search)
+- [`apollo file delete`](#apollo-file-delete)
+- [`apollo file download`](#apollo-file-download)
+- [`apollo file get`](#apollo-file-get)
+- [`apollo file upload INPUT-FILE`](#apollo-file-upload-input-file)
 - [`apollo help [COMMANDS]`](#apollo-help-commands)
+- [`apollo jbrowse get-config`](#apollo-jbrowse-get-config)
+- [`apollo jbrowse set-config INPUTFILE`](#apollo-jbrowse-set-config-inputfile)
+- [`apollo login`](#apollo-login)
+- [`apollo logout`](#apollo-logout)
+- [`apollo refseq add-alias INPUT-FILE`](#apollo-refseq-add-alias-input-file)
+- [`apollo refseq get`](#apollo-refseq-get)
+- [`apollo status`](#apollo-status)
+- [`apollo user get`](#apollo-user-get)
+
+## `apollo assembly add-from-fasta INPUT`
+
+Add a new assembly from fasta input
+
+```
+USAGE
+  $ apollo assembly add-from-fasta INPUT [--profile <value>] [--config-file <value>] [-a <value>] [-f] [-e] [--fai <value>]
+    [--gzi <value>] [-z | -d]
+
+ARGUMENTS
+  INPUT  Input fasta file, local or remote, or id of a previously uploaded file. For local or remote files, it is
+         assumed the file is bgzip'd with `bgzip` and indexed with `samtools faidx`. The indexes are assumed to be at
+         <my.fasta.gz>.fai and <my.fasta.gz>.gzi unless the options --fai and --gzi are provided.
+
+FLAGS
+  -a, --assembly=<value>     Name for this assembly. Use the file name if omitted
+  -d, --decompressed         For local file input: Override autodetection and instruct that input is decompressed
+  -e, --editable             Instead of using indexed fasta lookup, the sequence is loaded into the Apollo database and
+                             is editable. Use with caution, as editing the sequence often has unintended side effects.
+  -f, --force                Delete existing assembly, if it exists
+  -z, --gzip                 For local file input: Override autodetection and instruct that input is gzip compressed
+      --config-file=<value>  Use this config file (mostly for testing)
+      --fai=<value>          Fasta index of the (not-editable) fasta file
+      --gzi=<value>          Gzi index of the (not-editable) fasta file
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Add a new assembly from fasta input
+
+  Add new assembly. The input fasta may be:
+  * A local file
+  * An external fasta file
+  * The id of a file previously uploaded to Apollo
+
+EXAMPLES
+  From local file:
+
+    $ apollo assembly add-from-fasta genome.fa -a myAssembly
+
+  From external source we also need the URL of the index:
+
+    $ apollo assembly add-from-fasta https://.../genome.fa -x https://.../genome.fa.fai -a myAssembly
+```
+
+_See code:
+[src/commands/assembly/add-from-fasta.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts)_
+
+## `apollo assembly add-from-gff INPUT-FILE`
+
+Add new assembly from gff or gft file
+
+```
+USAGE
+  $ apollo assembly add-from-gff INPUT-FILE [--profile <value>] [--config-file <value>] [-a <value>] [-o] [-f]
+
+ARGUMENTS
+  INPUT-FILE  Input gff file
+
+FLAGS
+  -a, --assembly=<value>     Name for this assembly. Use the file name if omitted
+  -f, --force                Delete existing assembly, if it exists
+  -o, --omit-features        Do not import features, only upload the sequences
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Add new assembly from gff or gft file
+
+  The gff file is expected to contain sequences as per gff specifications. Features are also imported by default.
+
+EXAMPLES
+  Import sequences and features:
+
+    $ apollo assembly add-from-gff genome.gff -a myAssembly
+
+  Import sequences only:
+
+    $ apollo assembly add-from-gff genome.gff -a myAssembly -o
+```
+
+_See code:
+[src/commands/assembly/add-from-gff.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/add-from-gff.ts)_
+
+## `apollo assembly check`
+
+Add, view, or delete checks to assembly
+
+```
+USAGE
+  $ apollo assembly check [--profile <value>] [--config-file <value>] [-a <value>] [-c <value>] [-d]
+
+FLAGS
+  -a, --assembly=<value>     Manage checks in this assembly
+  -c, --check=<value>...     Add these check names or IDs. If unset, print the checks set for assembly
+  -d, --delete               Delete (instead of adding) checks
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Add, view, or delete checks to assembly
+
+  Manage checks, i.e. the rules ensuring features in an assembly are plausible. This command only sets the checks to
+  apply, to retrieve features flagged by these checks use `apollo feature check`.
+
+EXAMPLES
+  View available check types:
+
+    $ apollo assembly check
+
+  View checks set for assembly hg19:
+
+    $ apollo assembly check -a hg19
+
+  Add checks to assembly:
+
+    $ apollo assembly check -a hg19 -c CDSCheck
+
+  Delete checks from assembly:
+
+    $ apollo assembly check -a hg19 -c CDSCheck --delete
+```
+
+_See code:
+[src/commands/assembly/check.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/check.ts)_
+
+## `apollo assembly delete`
+
+Delete assemblies
+
+```
+USAGE
+  $ apollo assembly delete -a <value> [--profile <value>] [--config-file <value>] [-v]
+
+FLAGS
+  -a, --assembly=<value>...  (required) Assembly names or IDs to delete
+  -v, --verbose              Print to stdout the array of assemblies deleted
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Delete assemblies
+
+  Assemblies to delete may be names or IDs
+
+EXAMPLES
+  Delete multiple assemblies using name or ID:
+
+    $ apollo assembly delete -a mouse 6605826fbd0eee691f83e73f
+```
+
+_See code:
+[src/commands/assembly/delete.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/delete.ts)_
+
+## `apollo assembly get`
+
+Get available assemblies
+
+```
+USAGE
+  $ apollo assembly get [--profile <value>] [--config-file <value>] [-a <value>]
+
+FLAGS
+  -a, --assembly=<value>...  Get assemblies in this list of names or IDs
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get available assemblies
+
+  Print to stdout the list of assemblies in json format
+```
+
+_See code:
+[src/commands/assembly/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/get.ts)_
+
+## `apollo assembly sequence`
+
+Get reference sequence in fasta format
+
+```
+USAGE
+  $ apollo assembly sequence [--profile <value>] [--config-file <value>] [-a <value>] [-r <value>] [-s <value>] [-e
+    <value>]
+
+FLAGS
+  -a, --assembly=<value>     Find input reference sequence in this assembly
+  -e, --end=<value>          End coordinate
+  -r, --refseq=<value>       Reference sequence. If unset, get all sequences
+  -s, --start=<value>        [default: 1] Start coordinate (1-based)
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get reference sequence in fasta format
+
+  Return the reference sequence for a given assembly and coordinates
+
+EXAMPLES
+  Get all sequences in myAssembly:
+
+    $ apollo assembly sequence -a myAssembly
+
+  Get sequence in coordinates chr1:1..1000:
+
+    $ apollo assembly sequence -a myAssembly -r chr1 -s 1 -e 1000
+```
+
+_See code:
+[src/commands/assembly/sequence.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/sequence.ts)_
+
+## `apollo change get`
+
+Get list of changes
+
+```
+USAGE
+  $ apollo change get [--profile <value>] [--config-file <value>] [-a <value>]
+
+FLAGS
+  -a, --assembly=<value>...  Get changes only for these assembly names or IDs (but see description)
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get list of changes
+
+  Return the change log in json format. Note that when an assembly is deleted the link between common name and ID is
+  lost (it can still be recovered by inspecting the change log but at present this task is left to the user). In such
+  cases you need to use the assembly ID.
+```
+
+_See code:
+[src/commands/change/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/change/get.ts)_
+
+## `apollo config [KEY] [VALUE]`
+
+Get or set apollo configuration options
+
+```
+USAGE
+  $ apollo config [KEY] [VALUE] [--profile <value>] [---file <value>] [--get-config-file]
+
+ARGUMENTS
+  KEY    Name of configuration parameter
+  VALUE  Parameter value
+
+FLAGS
+  --config-file=<value>  Use this config file (mostly for testing)
+  --get-config-file      Return the path to the config file and exit (this file may not exist yet)
+  --profile=<value>      Profile to create or edit
+
+DESCRIPTION
+  Get or set apollo configuration options
+
+  Use this command to create or edit a user profile with credentials to access Apollo. Configuration options are:
+
+  - address:
+  Address and port e.g http://localhost:3999
+
+  - accessType:
+  How to access Apollo. accessType is typically one of: google, microsoft, guest, root. Allowed types depend on your
+  Apollo setup
+
+  - accessToken:
+  Access token. Usually inserted by `apollo login`
+
+  - rootCredentials.username:
+  Username of root account. Only set this for "root" access type
+
+  - rootCredentials.password:
+  Password for root account. Only set this for "root" access type
+
+EXAMPLES
+  Interactive setup:
+
+    $ apollo config
+
+  Setup with key/value pairs:
+
+    $ apollo config --profile admin address http://localhost:3999
+
+  Get current address for default profile:
+
+    $ apollo config address
+```
+
+_See code:
+[src/commands/config.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/config.ts)_
+
+## `apollo feature add-child`
+
+Add a child feature (e.g. add an exon to an mRNA)
+
+```
+USAGE
+  $ apollo feature add-child -s <value> -e <value> -t <value> [--profile <value>] [--config-file <value>] [-i <value>]
+
+FLAGS
+  -e, --end=<value>          (required) End coordinate of the child feature (1-based)
+  -i, --feature-id=<value>   [default: -] Add a child to this feature ID; use - to read it from stdin
+  -s, --start=<value>        (required) Start coordinate of the child feature (1-based)
+  -t, --type=<value>         (required) Type of child feature
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Add a child feature (e.g. add an exon to an mRNA)
+
+  See the other commands under `apollo feature` to retrive the parent ID of interest and to populate the child feature
+  with attributes.
+
+EXAMPLES
+  Add an exon at genomic coordinates 10..20 to this feature ID:
+
+    $ apollo feature add-child -i 660...73f -t exon -s 10 -e 20
+```
+
+_See code:
+[src/commands/feature/add-child.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/add-child.ts)_
+
+## `apollo feature check`
+
+Get check results
+
+```
+USAGE
+  $ apollo feature check [--profile <value>] [--config-file <value>] [-i <value>] [-a <value>]
+
+FLAGS
+  -a, --assembly=<value>       Get checks for this assembly
+  -i, --feature-id=<value>...  Get checks for these feature identifiers
+      --config-file=<value>    Use this config file (mostly for testing)
+      --profile=<value>        Use credentials from this profile
+
+DESCRIPTION
+  Get check results
+
+  Use this command to view which features fail checks along with the reason for failing.Use `apollo assembly check` for
+  managing which checks should be applied to an assembly
+
+EXAMPLES
+  Get all check results in the database:
+
+    $ apollo feature check
+
+  Get check results for assembly hg19:
+
+    $ apollo feature check -a hg19
+```
+
+_See code:
+[src/commands/feature/check.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/check.ts)_
+
+## `apollo feature copy`
+
+Copy a feature to another location
+
+```
+USAGE
+  $ apollo feature copy -r <value> -s <value> [--profile <value>] [--config-file <value>] [-i <value>] [-a <value>]
+
+FLAGS
+  -a, --assembly=<value>     Name or ID of target assembly. Not required if refseq is unique in the database
+  -i, --feature-id=<value>   [default: -] Feature ID to copy to; use - to read it from stdin
+  -r, --refseq=<value>       (required) Name or ID of target reference sequence
+  -s, --start=<value>        (required) Start position in target reference sequence
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Copy a feature to another location
+
+  The feature may be copied to the same or to a different assembly. The destination reference sequence may be selected
+  by name only if unique in the database or by name and assembly or by identifier.
+
+EXAMPLES
+  Copy this feature ID to chr1:100 in assembly hg38:
+
+    $ apollo feature copy -i 6605826fbd0eee691f83e73f -r chr1 -s 100 -a hg38
+```
+
+_See code:
+[src/commands/feature/copy.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/copy.ts)_
+
+## `apollo feature delete`
+
+Delete one or more features by ID
+
+```
+USAGE
+  $ apollo feature delete [--profile <value>] [--config-file <value>] [-i <value>] [-f] [-n]
+
+FLAGS
+  -f, --force                  Ignore non-existing features
+  -i, --feature-id=<value>...  [default: -] Feature IDs to delete
+  -n, --dry-run                Only show what would be delete
+      --config-file=<value>    Use this config file (mostly for testing)
+      --profile=<value>        Use credentials from this profile
+
+DESCRIPTION
+  Delete one or more features by ID
+
+  Note that deleting a child feature after deleting its parent will result in an error unless you set -f/--force.
+```
+
+_See code:
+[src/commands/feature/delete.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/delete.ts)_
+
+## `apollo feature edit`
+
+Edit features using an appropiate json input
+
+```
+USAGE
+  $ apollo feature edit [--profile <value>] [--config-file <value>] [-j <value>]
+
+FLAGS
+  -j, --json-input=<value>   [default: -] Json string or json file or "-" to read json from stdin
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Edit features using an appropiate json input
+
+  Edit a feature by submitting a json input with all the required attributes for Apollo to process it. This is a very
+  low level command which most users probably do not need.
+
+  Input may be a json string or a json file and it may be an array of changes. This is an example input for editing
+  feature type:
+
+  {
+  "typeName": "TypeChange",
+  "changedIds": [
+  "6613f7d22c957525d631b1cc"
+  ],
+  "assembly": "6613f7d1360321540a11e5ed",
+  "featureId": "6613f7d22c957525d631b1cc",
+  "oldType": "BAC",
+  "newType": "G_quartet"
+  }
+
+EXAMPLES
+  Editing by passing a json to stdin:
+
+    echo '{"typeName": ... "newType": "G_quartet"}' | apollo feature edit -j -
+```
+
+_See code:
+[src/commands/feature/edit.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/edit.ts)_
+
+## `apollo feature edit-attribute`
+
+Add, edit, or view a feature attribute
+
+```
+USAGE
+  $ apollo feature edit-attribute -a <value> [--profile <value>] [--config-file <value>] [-i <value>] [-v <value>] [-d]
+
+FLAGS
+  -a, --attribute=<value>    (required) Attribute key to add or edit
+  -d, --delete               Delete this attribute
+  -i, --feature-id=<value>   [default: -] Feature ID to edit or "-" to read it from stdin
+  -v, --value=<value>...     New attribute value. Separated mutliple values by space to them as a list. If unset return
+                             current value
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Add, edit, or view a feature attribute
+
+  Be aware that there is no checking whether attributes names and values are valid. For example, you can create
+  non-unique ID attributes or you can set gene ontology terms to non-existing terms
+
+EXAMPLES
+  Add attribute "domains" with a list of values:
+
+    $ apollo feature edit-attribute -i 66...3f -a domains -v ABC PLD
+
+  Print values in "domains" as json array:
+
+    $ apollo feature edit-attribute -i 66...3f -a domains
+
+  Delete attribute "domains"
+
+    $ apollo feature edit-attribute -i 66...3f -a domains -d
+```
+
+_See code:
+[src/commands/feature/edit-attribute.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/edit-attribute.ts)_
+
+## `apollo feature edit-coords`
+
+Edit feature start and/or end coordinates
+
+```
+USAGE
+  $ apollo feature edit-coords [--profile <value>] [--config-file <value>] [-i <value>] [-s <value>] [-e <value>]
+
+FLAGS
+  -e, --end=<value>          New end coordinate (1-based)
+  -i, --feature-id=<value>   [default: -] Feature ID to edit or "-" to read it from stdin
+  -s, --start=<value>        New start coordinate (1-based)
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Edit feature start and/or end coordinates
+
+  If editing a child feature that new coordinates must be within the parent's coordinates.To get the identifier of the
+  feature to edit consider using `apollo feature get` or `apollo feature search`
+
+EXAMPLES
+  Edit start and end:
+
+    $ apollo feature edit-coords -i abc...xyz -s 10 -e 1000
+
+  Edit end and leave start as it is:
+
+    $ apollo feature edit-coords -i abc...xyz -e 2000
+```
+
+_See code:
+[src/commands/feature/edit-coords.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/edit-coords.ts)_
+
+## `apollo feature edit-type`
+
+Edit or view feature type
+
+```
+USAGE
+  $ apollo feature edit-type [--profile <value>] [--config-file <value>] [-i <value>] [-t <value>]
+
+FLAGS
+  -i, --feature-id=<value>   [default: -] Feature ID to edit or "-" to read it from stdin
+  -t, --type=<value>         Assign feature to this type. If unset return the current type
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Edit or view feature type
+
+  Feature type is column 3 in gff format.It must be a valid sequence ontology term although but the valifdity of the new
+  term is not checked.
+```
+
+_See code:
+[src/commands/feature/edit-type.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/edit-type.ts)_
+
+## `apollo feature get`
+
+Get features in assembly, reference sequence or genomic window
+
+```
+USAGE
+  $ apollo feature get [--profile <value>] [--config-file <value>] [-a <value>] [-r <value>] [-s <value>] [-e
+    <value>]
+
+FLAGS
+  -a, --assembly=<value>     Find input reference sequence in this assembly
+  -e, --end=<value>          End coordinate
+  -r, --refseq=<value>       Reference sequence. If unset, query all sequences
+  -s, --start=<value>        [default: 1] Start coordinate (1-based)
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get features in assembly, reference sequence or genomic window
+
+EXAMPLES
+  Get all features in myAssembly:
+
+    $ apollo feature get -a myAssembly
+
+  Get features intersecting chr1:1..1000. You can omit the assembly name if there are no other reference sequences
+  named chr1:
+
+    $ apollo feature get -a myAssembly -r chr1 -s 1 -e 1000
+```
+
+_See code:
+[src/commands/feature/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/get.ts)_
+
+## `apollo feature get-id`
+
+Get features given their identifiers
+
+```
+USAGE
+  $ apollo feature get-id [--profile <value>] [--config-file <value>] [-i <value>]
+
+FLAGS
+  -i, --feature-id=<value>...  [default: -] Retrieves feature with these IDs. Use "-" to read IDs from stdin (one per
+                               line)
+      --config-file=<value>    Use this config file (mostly for testing)
+      --profile=<value>        Use credentials from this profile
+
+DESCRIPTION
+  Get features given their identifiers
+
+  Invalid identifiers or identifiers not found in the database will be silently ignored
+
+EXAMPLES
+  Get features for these identifiers:
+
+    $ apollo feature get-id -i abc...zyz def...foo
+```
+
+_See code:
+[src/commands/feature/get-id.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/get-id.ts)_
+
+## `apollo feature import INPUT-FILE`
+
+Import features from local gff file
+
+```
+USAGE
+  $ apollo feature import INPUT-FILE -a <value> [--profile <value>] [--config-file <value>] [-d]
+
+ARGUMENTS
+  INPUT-FILE  Input gff file
+
+FLAGS
+  -a, --assembly=<value>     (required) Import into this assembly name or assembly ID
+  -d, --delete-existing      Delete existing features before importing
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Import features from local gff file
+
+  By default, features are added to the existing ones.
+
+EXAMPLES
+  Delete features in myAssembly and then import features.gff3:
+
+    $ apollo feature import features.gff3 -d -a myAssembly
+```
+
+_See code:
+[src/commands/feature/import.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/import.ts)_
+
+## `apollo feature search`
+
+Free text search for feature in one or more assemblies
+
+```
+USAGE
+  $ apollo feature search -t <value> [--profile <value>] [--config-file <value>] [-a <value>]
+
+FLAGS
+  -a, --assembly=<value>...  Assembly names or IDs to search; use "-" to read it from stdin. If omitted search all
+                             assemblies
+  -t, --text=<value>         (required) Search for this text query
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Free text search for feature in one or more assemblies
+
+  Return features matching a query string. This command searches only in:
+
+  - Attribute *values* (not attribute names)
+  - Source field (which in fact is stored as an attribute)
+  - Feature type
+
+  The search mode is:
+
+  - Case insensitive
+  - Match only full words, but not necessarily the full value
+  - Common words are ignored. E.g. "the", "with"
+
+  For example, given this feature:
+
+  chr1 example SNP 10 30 0.987 . . "someKey=Fingerprint BAC with reads"
+
+  Queries "bac" or "mRNA" return the feature. Instead these queries will NOT match:
+
+  - "someKey"
+  - "with"
+  - "Finger"
+  - "chr1"
+  - "0.987"
+
+EXAMPLES
+  Search "bac" in these assemblies:
+
+    $ apollo feature search -a mm9 mm10 -t bac
+```
+
+_See code:
+[src/commands/feature/search.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/search.ts)_
+
+## `apollo file delete`
+
+Delete files from the Apollo server
+
+```
+USAGE
+  $ apollo file delete [--profile <value>] [--config-file <value>] [-i <value>]
+
+FLAGS
+  -i, --file-id=<value>...   [default: -] IDs of the files to delete
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Delete files from the Apollo server
+
+  Deleted files are printed to stdout. See also `apollo file get` to list the files on the server
+
+EXAMPLES
+  Delete file multiple files:
+
+    $ apollo file delete -i 123...abc xyz...789
+```
+
+_See code:
+[src/commands/file/delete.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/delete.ts)_
+
+## `apollo file download`
+
+Download a file from the Apollo server
+
+```
+USAGE
+  $ apollo file download [--profile <value>] [--config-file <value>] [-i <value>] [-o <value>]
+
+FLAGS
+  -i, --file-id=<value>      [default: -] ID of the file to download
+  -o, --output=<value>       Write output to this file or "-" for stdout. Default to the name of the uploaded file.
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Download a file from the Apollo server
+
+  See also `apollo file get` to list the files on the server
+
+EXAMPLES
+  Download file with id xyz
+
+    $ apollo file download -i xyz -o genome.fa
+```
+
+_See code:
+[src/commands/file/download.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/download.ts)_
+
+## `apollo file get`
+
+Get list of files uploaded to the Apollo server
+
+```
+USAGE
+  $ apollo file get [--profile <value>] [--config-file <value>] [-i <value>]
+
+FLAGS
+  -i, --file-id=<value>...   Get files matching this IDs
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get list of files uploaded to the Apollo server
+
+  Print to stdout the list of files in json format
+
+EXAMPLES
+  Get files by id:
+
+    $ apollo file get -i xyz abc
+```
+
+_See code:
+[src/commands/file/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/get.ts)_
+
+## `apollo file upload INPUT-FILE`
+
+Upload a local file to the Apollo server
+
+```
+USAGE
+  $ apollo file upload INPUT-FILE [--profile <value>] [--config-file <value>] [-t
+    text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi] [-z | -d]
+
+ARGUMENTS
+  INPUT-FILE  Local file to upload
+
+FLAGS
+  -d, --decompressed         Override autodetection and instruct that input is decompressed
+  -t, --type=<option>        Set file type or autodetected it if not set.
+                             NB: There is no check for whether the file complies to this type
+                             <options: text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi>
+  -z, --gzip                 Override autodetection and instruct that input is gzip compressed
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Upload a local file to the Apollo server
+
+  This command only uploads a file and returns the corresponding file id.
+  To add an assembly based on this file or to upload & add an assembly in a single pass   see `apollo assembly
+  add-from-fasta` and `add-from-gff`
+
+EXAMPLES
+  Upload local file, type auto-detected:
+
+    $ apollo file upload genome.fa > file.json
+```
+
+_See code:
+[src/commands/file/upload.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/upload.ts)_
 
 ## `apollo help [COMMANDS]`
 
@@ -52,4 +895,249 @@ DESCRIPTION
 _See code:
 [@oclif/plugin-help](https://github.com/oclif/plugin-help/blob/v6.0.8/src/commands/help.ts)_
 
+## `apollo jbrowse get-config`
+
+Get JBrowse configuration from Apollo
+
+```
+USAGE
+  $ apollo jbrowse get-config [--profile <value>] [--config-file <value>]
+
+FLAGS
+  --config-file=<value>  Use this config file (mostly for testing)
+  --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get JBrowse configuration from Apollo
+
+  Print to stdout the JBrowse configuration from Apollo in JSON format
+
+EXAMPLES
+  Get JBrowse configuration:
+
+    $ apollo jbrowse get-config > config.json
+```
+
+_See code:
+[src/commands/jbrowse/get-config.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/jbrowse/get-config.ts)_
+
+## `apollo jbrowse set-config INPUTFILE`
+
+Set JBrowse configuration
+
+```
+USAGE
+  $ apollo jbrowse set-config INPUTFILE [--profile <value>] [--config-file <value>]
+
+ARGUMENTS
+  INPUTFILE  JBrowse configuration file
+
+FLAGS
+  --config-file=<value>  Use this config file (mostly for testing)
+  --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Set JBrowse configuration
+
+  Set JBrowse configuration in Apollo collaboration server
+
+EXAMPLES
+  Add JBrowse configuration:
+
+    $ apollo jbrowse set-config config.json
+```
+
+_See code:
+[src/commands/jbrowse/set-config.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/jbrowse/set-config.ts)_
+
+## `apollo login`
+
+Login to Apollo
+
+```
+USAGE
+  $ apollo login [--profile <value>] [--config-file <value>] [-a <value>] [-u <value>] [-p <value>] [-f]
+    [--port <value>]
+
+FLAGS
+  -a, --address=<value>      Address of Apollo server
+  -f, --force                Force re-authentication even if user is already logged in
+  -p, --password=<value>     Password for <username>
+  -u, --username=<value>     Username for root login
+      --config-file=<value>  Use this config file (mostly for testing)
+      --port=<value>         [default: 3000] Get token by listening to this port number (usually this is >= 1024 and <
+                             65536)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Login to Apollo
+
+  Use the provided credentials to obtain and save the token to access Apollo. Once the token for the given profile has
+  been saved in the configuration file, users do not normally need to execute this command again unless the token has
+  expired. To setup a new profile use "apollo config"
+
+EXAMPLES
+  The most basic and probably most typical usage is to login using the default profile in configuration file:
+
+    $ apollo login
+
+  Login with a different profile:
+
+    $ apollo login --profile my-profile
+```
+
+_See code:
+[src/commands/login.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/login.ts)_
+
+## `apollo logout`
+
+Logout of Apollo
+
+```
+USAGE
+  $ apollo logout [--profile <value>] [--config-file <value>]
+
+FLAGS
+  --config-file=<value>  Use this config file (mostly for testing)
+  --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Logout of Apollo
+
+  Logout by removing the access token from the selected profile
+
+EXAMPLES
+  Logout default profile:
+
+    $ apollo logout
+
+  Logout selected profile
+
+    $ apollo logout --profile my-profile
+```
+
+_See code:
+[src/commands/logout.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/logout.ts)_
+
+## `apollo refseq add-alias INPUT-FILE`
+
+Add reference name aliases from a file
+
+```
+USAGE
+  $ apollo refseq add-alias INPUT-FILE -a <value> [--profile <value>] [--config-file <value>]
+
+ARGUMENTS
+  INPUT-FILE  Input refname alias file
+
+FLAGS
+  -a, --assembly=<value>     (required) Name for this assembly.
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Add reference name aliases from a file
+
+  Reference name aliasing is a process to make chromosomes that are named slightly differently but which refer to the
+  same thing render properly. This command reads a file with reference name aliases and adds them to the database.
+
+EXAMPLES
+  Add reference name aliases:
+
+    $ apollo refseq add-alias alias.txt -a myAssembly
+```
+
+_See code:
+[src/commands/refseq/add-alias.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/refseq/add-alias.ts)_
+
+## `apollo refseq get`
+
+Get reference sequences
+
+```
+USAGE
+  $ apollo refseq get [--profile <value>] [--config-file <value>] [-a <value>]
+
+FLAGS
+  -a, --assembly=<value>...  Get reference sequences for these assembly names or IDs; use - to read it from stdin
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get reference sequences
+
+  Output the reference sequences in one or more assemblies in json format. This command returns the sequence
+  characteristics (e.g., name, ID, etc), not the DNA sequences. Use `assembly sequence` for that.
+
+EXAMPLES
+  All sequences in the database:
+
+    $ apollo refseq get
+
+  Only sequences for these assemblies:
+
+    $ apollo refseq get -a mm9 mm10
+```
+
+_See code:
+[src/commands/refseq/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/refseq/get.ts)_
+
+## `apollo status`
+
+View authentication status
+
+```
+USAGE
+  $ apollo status [--profile <value>] [--config-file <value>]
+
+FLAGS
+  --config-file=<value>  Use this config file (mostly for testing)
+  --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  View authentication status
+
+  This command returns "<profile>: Logged in" if the selected profile has an access token and "<profile>: Logged out"
+  otherwise.Note that this command does not check the validity of the access token.
+```
+
+_See code:
+[src/commands/status.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/status.ts)_
+
+## `apollo user get`
+
+Get list of users
+
+```
+USAGE
+  $ apollo user get [--profile <value>] [--config-file <value>] [-u <value>] [-r <value>]
+
+FLAGS
+  -r, --role=<value>         Get users with this role
+  -u, --username=<value>     Find this username
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get list of users
+
+  If set, filters username and role must be both satisfied to return an entry
+
+EXAMPLES
+  By username:
+
+    $ apollo user get -u Guest
+
+  By role:
+
+    $ apollo user get -r admin
+
+  Use jq for more control:
+
+    $ apollo user get | jq '.[] | select(.createdAt > "2024-03-18")'
+```
+
+_See code:
+[src/commands/user/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/user/get.ts)_
+
 <!-- commandsstop -->
diff --git a/packages/apollo-cli/src/commands/assembly/add-from-gff.ts b/packages/apollo-cli/src/commands/assembly/add-from-gff.ts
index acbb07137..1eede29bb 100644
--- a/packages/apollo-cli/src/commands/assembly/add-from-gff.ts
+++ b/packages/apollo-cli/src/commands/assembly/add-from-gff.ts
@@ -6,6 +6,11 @@ import { ObjectId } from 'bson'
 
 import { FileCommand } from '../../fileCommand.js'
 import { submitAssembly } from '../../utils.js'
+import type {
+  SerializedAddAssemblyAndFeaturesFromFileChange,
+  SerializedAddAssemblyFromExternalChange,
+  SerializedAddAssemblyFromFileChange,
+} from '@apollo-annotation/shared'
 
 export default class AddGff extends FileCommand {
   static summary = 'Add new assembly from gff or gft file'
@@ -63,19 +68,24 @@ export default class AddGff extends FileCommand {
       args['input-file'].endsWith('.gz'),
     )
 
-    let typeName = 'AddAssemblyAndFeaturesFromFileChange'
-    if (flags['omit-features']) {
-      typeName = 'AddAssemblyFromFileChange'
-    }
-
     const assemblyName = flags.assembly ?? path.basename(args['input-file'])
 
-    const body = {
-      assemblyName,
-      fileIds: { fa: fileId },
-      typeName,
-      assembly: new ObjectId().toHexString(),
-    }
+    const body:
+      | SerializedAddAssemblyFromFileChange
+      | SerializedAddAssemblyFromExternalChange
+      | SerializedAddAssemblyAndFeaturesFromFileChange = flags['omit-features']
+      ? {
+          assemblyName,
+          fileIds: { fa: fileId },
+          typeName: 'AddAssemblyFromFileChange',
+          assembly: new ObjectId().toHexString(),
+        }
+      : {
+          assemblyName,
+          fileIds: { fa: fileId },
+          typeName: 'AddAssemblyAndFeaturesFromFileChange',
+          assembly: new ObjectId().toHexString(),
+        }
     const rec = await submitAssembly(
       access.address,
       access.accessToken,
diff --git a/packages/apollo-cli/src/utils.ts b/packages/apollo-cli/src/utils.ts
index 4f50a7af6..897dd5749 100644
--- a/packages/apollo-cli/src/utils.ts
+++ b/packages/apollo-cli/src/utils.ts
@@ -3,10 +3,11 @@ import EventEmitter from 'node:events'
 import * as fs from 'node:fs'
 import { stdin, stderr } from 'node:process'
 
-import {
+import type {
+  SerializedAddAssemblyAndFeaturesFromFileChange,
   SerializedAddAssemblyFromExternalChange,
   SerializedAddAssemblyFromFileChange,
-  type SerializedDeleteAssemblyChange,
+  SerializedDeleteAssemblyChange,
 } from '@apollo-annotation/shared'
 
 import { Agent, RequestInit, Response, fetch } from 'undici'
@@ -362,7 +363,8 @@ export async function submitAssembly(
   accessToken: string,
   body:
     | SerializedAddAssemblyFromFileChange
-    | SerializedAddAssemblyFromExternalChange,
+    | SerializedAddAssemblyFromExternalChange
+    | SerializedAddAssemblyAndFeaturesFromFileChange,
   force: boolean,
 ): Promise<object> {
   let assemblies = await queryApollo(address, accessToken, 'assemblies')
diff --git a/packages/apollo-cli/test/test.py b/packages/apollo-cli/test/test.py
index e0436d3be..6cd28de7b 100755
--- a/packages/apollo-cli/test/test.py
+++ b/packages/apollo-cli/test/test.py
@@ -105,9 +105,9 @@ def testFeatureGet(self):
         self.assertTrue("returned 0 assemblies" in p.stderr)
 
     def testAssemblyGet(self):
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -f")
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv2 -f")
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv3 -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -e -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv2 -e -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv3 -e -f")
         p = shell(f"{apollo} assembly get {P}")
         self.assertTrue("vv1" in p.stdout)
         self.assertTrue("vv2" in p.stdout)
@@ -257,7 +257,7 @@ def testAddAssemblyLargeInput(self):
                 i += 1
 
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tmp.fa -a test -f",
+            f"{apollo} assembly add-from-fasta {P} test_data/tmp.fa -a test -e -f",
             timeout=60,
         )
         shell(
@@ -266,7 +266,7 @@ def testAddAssemblyLargeInput(self):
             timeout=60,
         )
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tmp.fa -a test -f",
+            f"{apollo} assembly add-from-fasta {P} test_data/tmp.fa -a test -e -f",
             timeout=60,
         )
 
@@ -274,7 +274,7 @@ def testAddAssemblyLargeInput(self):
 
     def testAddAssemblyFromLocalFasta(self):
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -f"
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -e -f"
         )
         out = json.loads(p.stdout)
         self.assertTrue("fa" in out["fileIds"].keys())
@@ -282,18 +282,18 @@ def testAddAssemblyFromLocalFasta(self):
         p = shell(f"{apollo} assembly get {P} -a vv1")
         self.assertTrue("vv1" in p.stdout)
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1",
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -e",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
         self.assertTrue('Error: Assembly "vv1" already exists' in p.stderr)
 
-        p = shell(f"{apollo} assembly add-from-fasta {P} na.fa -a vv1 -f", strict=False)
+        p = shell(f"{apollo} assembly add-from-fasta {P} na.fa -a vv1 -e -f", strict=False)
         self.assertTrue(p.returncode != 0)
         self.assertTrue("Input" in p.stderr)
 
         # Test default name
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -e -f")
         p = shell(f"{apollo} assembly get {P} -a tiny.fasta")
         self.assertTrue("tiny.fasta" in p.stdout)
 
@@ -312,7 +312,7 @@ def testAddAssemblyFromExternalFasta(self):
         self.assertEqual(seq[1], "cattgttgcg")
 
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} -a vv1 -f https://x.fa -x https://x.fai",
+            f"{apollo} assembly add-from-fasta {P} -a vv1 -f https://x.fa.gz --fai https://x.fa.gz.fai --gzi https://x.fa.gz.gzi",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
@@ -617,33 +617,33 @@ def testAddChildFeatures(self):
         self.assertEqual(p.returncode, 0)
 
     def testImportFeatures(self):
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -f")
-        shell(f"{apollo} feature import {P} -i test_data/tiny.fasta.gff3 -a vv1")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -e -f")
+        shell(f"{apollo} feature import {P} test_data/tiny.fasta.gff3 -a vv1")
         p = shell(f"{apollo} feature search {P} -a vv1 -t contig")
         out = json.loads(p.stdout)
         self.assertEqual(len(out), 2)
 
         # Import again: Add to existing feature
-        p = shell(f"{apollo} feature import {P} -i test_data/tiny.fasta.gff3 -a vv1")
+        p = shell(f"{apollo} feature import {P} test_data/tiny.fasta.gff3 -a vv1")
         p = shell(f"{apollo} feature search {P} -a vv1 -t contig")
         out = json.loads(p.stdout)
         self.assertEqual(len(out), 4)
 
         # Import again: delete {P} existing
-        p = shell(f"{apollo} feature import {P} -d -i test_data/tiny.fasta.gff3 -a vv1")
+        p = shell(f"{apollo} feature import {P} -d test_data/tiny.fasta.gff3 -a vv1")
         p = shell(f"{apollo} feature search {P} -a vv1 -t contig")
         out = json.loads(p.stdout)
         self.assertEqual(len(out), 2)
 
         p = shell(f"{apollo} assembly delete {P} -a vv2")
         p = shell(
-            f"{apollo} feature import {P} -i test_data/tiny.fasta.gff3 -a vv2",
+            f"{apollo} feature import {P} test_data/tiny.fasta.gff3 -a vv2",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
         self.assertTrue('Assembly "vv2" does not exist' in p.stderr)
 
-        p = shell(f"{apollo} feature import {P} -i foo.gff3 -a vv1", strict=False)
+        p = shell(f"{apollo} feature import {P} foo.gff3 -a vv1", strict=False)
         self.assertTrue(p.returncode != 0)
         self.assertTrue('File "foo.gff3" does not exist' in p.stderr)
 
@@ -651,8 +651,8 @@ def testCopyFeature(self):
         shell(
             f"{apollo} assembly add-from-gff {P} test_data/tiny.fasta.gff3 -a source -f"
         )
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a dest -f")
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a dest2 -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a dest -e -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a dest2 -e -f")
         p = shell(f"{apollo} feature search {P} -a source -t contig")
         fid = json.loads(p.stdout)[0]["_id"]
 
@@ -697,13 +697,13 @@ def testCopyFeature(self):
 
     def testGetChanges(self):
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a myAssembly -f"
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a myAssembly -e -f"
         )
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a yourAssembly -f"
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a yourAssembly -e -f"
         )
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a ourAssembly -f"
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a ourAssembly -e -f"
         )
 
         p = shell(f"{apollo} change get {P}")
@@ -725,8 +725,8 @@ def testGetChanges(self):
         self.assertEqual(len(out), 0)
 
     def testGetSequence(self):
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a v1 -f")
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a v2 -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a v1 -e -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a v2 -e -f")
 
         p = shell(f"{apollo} assembly sequence {P} -a nonExistant", strict=False)
         self.assertTrue(p.returncode != 0)
@@ -798,7 +798,8 @@ def testAssemblyChecks(self):
 
         # Test view checks set for assembly
         p = shell(f"{apollo} assembly check {P} -a v1")
-        self.assertEqual(p.stdout.strip(), "[]")
+        out = json.loads(p.stdout)
+        self.assertEqual(len(out), 1)
 
         # Test non-existant assembly
         p = shell(f"{apollo} assembly check {P} -a non-existant", strict=False)
@@ -836,25 +837,6 @@ def testFeatureChecks(self):
         shell(f"{apollo} assembly add-from-gff {P} test_data/tiny.fasta.gff3 -a v1 -f")
         shell(f"{apollo} assembly check {P} -a v1 -c CDSCheck")
         p = shell(f"{apollo} feature check {P} -a v1")
-        ## If we don't edit a feature, checks are not activated (!?)
-        self.assertEqual(p.stdout.strip(), "[]")
-
-        p = shell(f"{apollo} feature get {P} -a v1")
-        ff = json.loads(p.stdout)
-        g1 = [
-            x
-            for x in ff
-            if x["type"] == "gene" and x["attributes"]["gff_id"] == ["MyGene"]
-        ][0]
-        g2 = [
-            x
-            for x in ff
-            if x["type"] == "gene" and x["attributes"]["gff_id"] == ["AnotherGene"]
-        ][0]
-
-        shell(f"{apollo} feature edit-coords {P} -i {g1['_id']} -e 201")
-        shell(f"{apollo} feature edit-coords {P} -i {g2['_id']} -e 251")
-        p = shell(f"{apollo} feature check {P} -a v1")
         out = json.loads(p.stdout)
         self.assertTrue(len(out) > 1)
         self.assertTrue("InternalStopCodonCheck" in p.stdout)
@@ -872,30 +854,10 @@ def testFeatureChecks(self):
 
     def testFeatureChecksIndexed(self):
         shell(
-            f"{apollo} assembly add-from-fasta {P} -a v1 test_data/tiny.fasta.gz --not-editable -f"
+            f"{apollo} assembly add-from-fasta {P} -a v1 test_data/tiny.fasta.gz -f"
         )
-        shell(f"{apollo} feature import {P} -a v1 -i test_data/tiny.fasta.gff3 -d")
-        # shell(f"{apollo} assembly add-from-gff {P} test_data/tiny.fasta.gff3 -a v1 -f")
         shell(f"{apollo} assembly check {P} -a v1 -c CDSCheck")
-        p = shell(f"{apollo} feature check {P} -a v1")
-        ## If we don't edit a feature, checks are not activated (!?)
-        self.assertEqual(p.stdout.strip(), "[]")
-
-        p = shell(f"{apollo} feature get {P} -a v1")
-        ff = json.loads(p.stdout)
-        g1 = [
-            x
-            for x in ff
-            if x["type"] == "gene" and x["attributes"]["gff_id"] == ["MyGene"]
-        ][0]
-        g2 = [
-            x
-            for x in ff
-            if x["type"] == "gene" and x["attributes"]["gff_id"] == ["AnotherGene"]
-        ][0]
-
-        shell(f"{apollo} feature edit-coords {P} -i {g1['_id']} -e 201")
-        shell(f"{apollo} feature edit-coords {P} -i {g2['_id']} -e 251")
+        shell(f"{apollo} feature import {P} -a v1 test_data/tiny.fasta.gff3 -d")
         p = shell(f"{apollo} feature check {P} -a v1")
         out = json.loads(p.stdout)
         self.assertTrue(len(out) > 1)
@@ -992,13 +954,13 @@ def testRefNameAliasConfiguration(self):
         asm_id = json.loads(p.stdout)[0]["_id"]
 
         p = shell(
-            f"{apollo} refseq add-alias {P} -i test_data/alias.txt -a asm2",
+            f"{apollo} refseq add-alias {P} test_data/alias.txt -a asm2",
             strict=False,
         )
         self.assertTrue("Assembly asm2 not found" in p.stderr)
 
         p = shell(
-            f"{apollo} refseq add-alias {P} -i test_data/alias.txt -a asm1",
+            f"{apollo} refseq add-alias {P} test_data/alias.txt -a asm1",
             strict=False,
         )
         self.assertTrue(
@@ -1029,23 +991,23 @@ def testLogin(self):
         # This should be ok
         shell(f"{apollo} login {P} --force", timeout=5, strict=True)
     def testFileUpload(self):
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         out = json.loads(p.stdout)
         self.assertEqual("text/x-fasta", out["type"])
         self.assertTrue(out["_id"])
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         out = json.loads(p.stdout)
         self.assertEqual("text/x-fasta", out["type"])
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta.gff3")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta.gff3")
         out = json.loads(p.stdout)
         self.assertEqual("text/x-gff3", out["type"])
 
-        p = shell(f"{apollo} file upload {P} -i test_data/guest.yaml", strict=False)
+        p = shell(f"{apollo} file upload {P} test_data/guest.yaml", strict=False)
         self.assertTrue(p.returncode != 0)
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta.gz", strict=False)
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta.gz", strict=False)
         self.assertTrue("it may be gzip or bgzip compressed" in p.stderr)
         self.assertTrue(p.returncode != 0)
 
@@ -1054,15 +1016,15 @@ def testFileUploadGzip(self):
         with open("test_data/tiny.fasta.gz", "rb") as gz:
             md5 = hashlib.md5(gz.read()).hexdigest()
         p = shell(
-            f"{apollo} file upload {P} -i test_data/tiny.fasta.gz -t text/x-fasta"
+            f"{apollo} file upload {P} test_data/tiny.fasta.gz -t text/x-fasta"
         )
         out = json.loads(p.stdout)
         self.assertEqual(md5, out["checksum"])
-        shell(f"{apollo} assembly add-from-fasta {P} -f {out['_id']}")
+        shell(f"{apollo} assembly add-from-fasta {P} -e -f {out['_id']}")
 
     def testAddAssemblyGzip(self):
         # Autodetect format
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta.gz -f -a vv1")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta.gz -e -f -a vv1")
         p = shell(f"{apollo} assembly sequence {P} -a vv1")
         self.assertTrue(p.stdout.startswith(">"))
         self.assertTrue("cattgttgcggagttgaaca" in p.stdout)
@@ -1070,7 +1032,7 @@ def testAddAssemblyGzip(self):
         # Skip autodetect
         shutil.copy("test_data/tiny.fasta", "test_data/tmp.gz")
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tmp.gz -f -a vv1 --decompressed"
+            f"{apollo} assembly add-from-fasta {P} test_data/tmp.gz -e -f -a vv1 --decompressed"
         )
         p = shell(f"{apollo} assembly sequence {P} -a vv1")
         self.assertTrue(p.stdout.startswith(">"))
@@ -1079,7 +1041,7 @@ def testAddAssemblyGzip(self):
 
         shutil.copy("test_data/tiny.fasta.gz", "test_data/fasta.tmp")
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/fasta.tmp -f -a vv1 --gzip"
+            f"{apollo} assembly add-from-fasta {P} test_data/fasta.tmp -e -f -a vv1 --gzip"
         )
         p = shell(f"{apollo} assembly sequence {P} -a vv1")
         self.assertTrue(p.stdout.startswith(">"))
@@ -1087,7 +1049,7 @@ def testAddAssemblyGzip(self):
 
         # Autodetect false positive
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/fasta.tmp -f -a vv1",
+            f"{apollo} assembly add-from-fasta {P} test_data/fasta.tmp -e -f -a vv1",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
@@ -1096,21 +1058,21 @@ def testAddAssemblyGzip(self):
     def testAddAssemblyFromFilesNotEditable(self):
         # It would be good to check that really there was no sequence loading
         shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable test_data/tiny.fasta.gz"
+            f"{apollo} assembly add-from-fasta {P} -f test_data/tiny.fasta.gz"
         )
         p = shell(f"{apollo} assembly sequence {P} -a tiny.fasta.gz")
         self.assertTrue(p.stdout.startswith(">"))
         self.assertTrue("cattgttgcggagttgaaca" in p.stdout)
 
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable test_data/tiny.fasta",
+            f"{apollo} assembly add-from-fasta {P} -f test_data/tiny.fasta",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
 
         # Setting --gzi & --fai
         shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable test_data/tiny2.fasta.gz --gzi test_data/tiny.fasta.gz.gzi --fai test_data/tiny.fasta.gz.fai"
+            f"{apollo} assembly add-from-fasta {P} -f test_data/tiny2.fasta.gz --gzi test_data/tiny.fasta.gz.gzi --fai test_data/tiny.fasta.gz.fai"
         )
         p = shell(f"{apollo} assembly sequence {P} -a tiny2.fasta.gz")
         self.assertTrue(p.stdout.startswith(">"))
@@ -1119,48 +1081,48 @@ def testAddAssemblyFromFilesNotEditable(self):
     def testAddAssemblyFromFileIdsNotEditable(self):
         # Upload and get Ids for: bgzip fasta, fai and gzi
         p = shell(
-            f"{apollo} file upload {P} -i test_data/tiny.fasta.gz -t application/x-bgzip-fasta"
+            f"{apollo} file upload {P} test_data/tiny.fasta.gz -t application/x-bgzip-fasta"
         )
         fastaId = json.loads(p.stdout)["_id"]
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta.gz.fai")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta.gz.fai")
         faiId = json.loads(p.stdout)["_id"]
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta.gz.gzi")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta.gz.gzi")
         gziId = json.loads(p.stdout)["_id"]
 
         shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable {fastaId} --fai test_data/tiny.fasta.gz.fai --gzi test_data/tiny.fasta.gz.gzi"
+            f"{apollo} assembly add-from-fasta {P} -f {fastaId} --fai test_data/tiny.fasta.gz.fai --gzi test_data/tiny.fasta.gz.gzi"
         )
         p = shell(f"{apollo} assembly sequence {P} -a {fastaId}")
         self.assertTrue(p.stdout.startswith(">"))
         self.assertTrue("cattgttgcggagttgaaca" in p.stdout)
 
         shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable {fastaId} --fai {faiId} --gzi {gziId}"
+            f"{apollo} assembly add-from-fasta {P} -f {fastaId} --fai {faiId} --gzi {gziId}"
         )
         p = shell(f"{apollo} assembly sequence {P} -a {fastaId}")
         self.assertTrue(p.stdout.startswith(">"))
 
     def testAddAssemblyFromFileId(self):
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         fid = json.loads(p.stdout)["_id"]
-        p = shell(f"{apollo} assembly add-from-fasta {P} {fid} -a up -f")
+        p = shell(f"{apollo} assembly add-from-fasta {P} {fid} -a up -e -f")
         out = json.loads(p.stdout)
         self.assertEqual("up", out["name"])
         self.assertEqual(fid, out["fileIds"]["fa"])
 
         # shell(f"{apollo} assembly delete {P} -a up")
         # shell(
-        #     f"{apollo} file upload {P} -i test_data/tiny.fasta | {apollo} assembly add-from-fasta {P} -a up -f"
+        #     f"{apollo} file upload {P} test_data/tiny.fasta | {apollo} assembly add-from-fasta {P} -a up -e -f"
         # )
         # p = shell(f"{apollo} assembly get {P} -a up")
         # out = json.loads(p.stdout)
         # self.assertEqual("up", out[0]["name"])
 
     def testGetFiles(self):
-        shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        shell(f"{apollo} file upload {P} test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         fid = json.loads(p.stdout)["_id"]
 
         p = shell(f"{apollo} file get {P}")
@@ -1177,7 +1139,7 @@ def testGetFiles(self):
         self.assertEqual(0, len(out))
 
     def testDownloadFile(self):
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         up = json.loads(p.stdout)
         if os.path.exists(up["basename"]):
             raise Exception(
@@ -1203,9 +1165,9 @@ def testDownloadFile(self):
         self.assertTrue(p.stdout.strip().endswith("accc"))
 
     def testDeleteFile(self):
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         up1 = json.loads(p.stdout)
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         up2 = json.loads(p.stdout)
 
         p = shell(f"{apollo} file delete {P} -i {up1['_id']} {up2['_id']}")
diff --git a/packages/website/docs/cli/assembly.md b/packages/website/docs/cli/assembly.md
index ad29d11ad..e1771b6b5 100644
--- a/packages/website/docs/cli/assembly.md
+++ b/packages/website/docs/cli/assembly.md
@@ -15,21 +15,20 @@ Add a new assembly from fasta input
 
 ```
 USAGE
-  $ apollo assembly add-from-fasta INPUT [--profile <value>] [--config-file <value>] [-a <value>] [-x <value>] [-f] [-n]
-    [--fai <value>] [--gzi <value>] [-z | -d]
+  $ apollo assembly add-from-fasta INPUT [--profile <value>] [--config-file <value>] [-a <value>] [-f] [-e] [--fai <value>]
+    [--gzi <value>] [-z | -d]
 
 ARGUMENTS
-  INPUT  Input fasta file, local or remote, or id of a previously uploaded file
+  INPUT  Input fasta file, local or remote, or id of a previously uploaded file. For local or remote files, it is
+         assumed the file is bgzip'd with `bgzip` and indexed with `samtools faidx`. The indexes are assumed to be at
+         <my.fasta.gz>.fai and <my.fasta.gz>.gzi unless the options --fai and --gzi are provided.
 
 FLAGS
   -a, --assembly=<value>     Name for this assembly. Use the file name if omitted
   -d, --decompressed         For local file input: Override autodetection and instruct that input is decompressed
+  -e, --editable             Instead of using indexed fasta lookup, the sequence is loaded into the Apollo database and
+                             is editable. Use with caution, as editing the sequence often has unintended side effects.
   -f, --force                Delete existing assembly, if it exists
-  -n, --not-editable         The fasta sequence is not editable. Apollo will not load it into the database and instead
-                             use the provided indexes to query it. This option assumes the fasta file is bgzip'd with
-                             `bgzip` and indexed with `samtools faidx`. Indexes should be named <my.fasta.gz>.gzi and
-                             <my.fasta.gz>.fai unless options --fai and --gzi are set
-  -x, --index=<value>        URL of the index. Required if input is an external source
   -z, --gzip                 For local file input: Override autodetection and instruct that input is gzip compressed
       --config-file=<value>  Use this config file (mostly for testing)
       --fai=<value>          Fasta index of the (not-editable) fasta file