Skip to content

Commit

Permalink
Set up Github Actions and bumpversion
Browse files Browse the repository at this point in the history
  • Loading branch information
veghp committed Jun 24, 2024
1 parent 237ded5 commit b5ebd24
Show file tree
Hide file tree
Showing 6 changed files with 36 additions and 16 deletions.
8 changes: 8 additions & 0 deletions .bumpversion.cfg
Original file line number Diff line number Diff line change
@@ -0,0 +1,8 @@
[bumpversion]
current_version = 0.2.0
commit = True
tag = True

[bumpversion:file:README.md]

[bumpversion:file:epijinn/version.py]
24 changes: 24 additions & 0 deletions .github/workflows/build.yml
Original file line number Diff line number Diff line change
@@ -0,0 +1,24 @@
name: build

on: [workflow_dispatch]

jobs:
build:
runs-on: ubuntu-20.04

steps:
- uses: actions/checkout@v2
- name: Set up Python 3.9.12
uses: actions/setup-python@v2
with:
python-version: "3.9.12"
- name: Install dependencies
run: |
python -m pip install --upgrade pip
pip install pytest
- name: Test pip installation
run: |
pip install -e .
- name: Test with pytest
run: |
python -m pytest
12 changes: 0 additions & 12 deletions .travis.yml

This file was deleted.

4 changes: 2 additions & 2 deletions README.md
Original file line number Diff line number Diff line change
Expand Up @@ -4,8 +4,8 @@

# EpiJinn

[![Build Status](https://travis-ci.org/Edinburgh-Genome-Foundry/EpiJinn.svg?branch=main)](https://travis-ci.org/Edinburgh-Genome-Foundry/EpiJinn)
[![Coverage Status](https://coveralls.io/repos/github/Edinburgh-Genome-Foundry/EpiJinn/badge.svg?branch=main)](https://coveralls.io/github/Edinburgh-Genome-Foundry/EpiJinn?branch=main)
![version](https://img.shields.io/badge/current_version-0.2.0-blue)
[![build](https://github.com/Edinburgh-Genome-Foundry/EpiJinn/actions/workflows/build.yml/badge.svg)](https://github.com/Edinburgh-Genome-Foundry/EpiJinn/actions/workflows/build.yml)

**Work in progress!**

Expand Down
2 changes: 1 addition & 1 deletion epijinn/version.py
Original file line number Diff line number Diff line change
@@ -1 +1 @@
__version__ = "0.1.1"
__version__ = "0.2.0"
2 changes: 1 addition & 1 deletion tests/test_epijinn.py
Original file line number Diff line number Diff line change
Expand Up @@ -32,4 +32,4 @@ def test_annotate_methylation():
dna = Seq("TGACCCCCCCCTGCTCCCCCAGCACCCCCCCCTCA")
dna_record = SeqRecord(dna, id="example", annotations={"molecule_type": "dna"})
dna_annotated = epijinn.annotate_methylation(dna_record)
assert len(dna_annotated.features) == 6
assert len(dna_annotated.features) == 12

0 comments on commit b5ebd24

Please sign in to comment.