generated from jonn-smith/python_cli_template
-
Notifications
You must be signed in to change notification settings - Fork 4
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
1 parent
c2f0b49
commit 997d80b
Showing
21 changed files
with
446 additions
and
430 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
File renamed without changes.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,59 @@ | ||
{ | ||
"cdna": { | ||
"description": "bulk 10x 5' kit", | ||
"version": "3.0.0", | ||
"structure": [ | ||
"5p_Adapter", | ||
"UMI", | ||
"SLS", | ||
"cDNA", | ||
"Poly_A", | ||
"sample_index", | ||
"3p_Adapter" | ||
], | ||
"adapters": { | ||
"5p_Adapter": "TCTACACGACGCTCTTCCGATCT", | ||
"UMI": { | ||
"FixedLengthRandomBases": 10 | ||
}, | ||
"SLS": "TTTCTTATATGGG", | ||
"cDNA": "random", | ||
"Poly_A": { | ||
"HomopolymerRepeat": [ | ||
"A", | ||
30 | ||
] | ||
}, | ||
"sample_index": { | ||
"FixedLengthRandomBases": 10 | ||
}, | ||
"3p_Adapter": "CTCTGCGTTGATACCACTGCTT" | ||
}, | ||
"named_random_segments": [ | ||
"UMI", | ||
"cDNA", | ||
"sample_index" | ||
], | ||
"coding_region": "cDNA", | ||
"annotation_segments": { | ||
"UMI": [ | ||
[ | ||
"ZU", | ||
"XU" | ||
], | ||
[ | ||
"XM", | ||
"XU" | ||
] | ||
], | ||
"sample_index": [ | ||
[ | ||
"id", | ||
"ip" | ||
] | ||
] | ||
}, | ||
"deprecated": false, | ||
"name": "bulk_10x5p" | ||
} | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,42 @@ | ||
{ | ||
"cdna": { | ||
"description": "Lexogen TeloPrime V2 kit", | ||
"version": "3.0.0", | ||
"structure": [ | ||
"TPV2_adapter", | ||
"cDNA", | ||
"Poly_A", | ||
"idx", | ||
"rev_bind" | ||
], | ||
"adapters": { | ||
"TPV2_adapter": "CTACACGACGCTCTTCCGATCTTGGATTGATATGTAATACGACTCACTATAG", | ||
"cDNA": "random", | ||
"Poly_A": { | ||
"HomopolymerRepeat": [ | ||
"A", | ||
30 | ||
] | ||
}, | ||
"idx": { | ||
"FixedLengthRandomBases": 10 | ||
}, | ||
"rev_bind": "CTCTGCGTTGATACCACTGCTT" | ||
}, | ||
"named_random_segments": [ | ||
"idx", | ||
"cDNA" | ||
], | ||
"coding_region": "cDNA", | ||
"annotation_segments": { | ||
"idx": [ | ||
[ | ||
"BC", | ||
"XB" | ||
] | ||
] | ||
}, | ||
"deprecated": false, | ||
"name": "bulk_teloprimeV2" | ||
} | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,16 @@ | ||
{ | ||
"array": { | ||
"description": "PacBio IsoSeq model", | ||
"version": "3.0.0", | ||
"structure": [ | ||
"V", | ||
"M" | ||
], | ||
"adapters": { | ||
"V": "TCTACACGACGCTCTTCCGATCT", | ||
"M": "GTACTCTGCGTTGATACCACTGCTT" | ||
}, | ||
"deprecated": false, | ||
"name": "isoseq" | ||
} | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,34 @@ | ||
{ | ||
"array": { | ||
"description": "10-element MAS-ISO-seq array", | ||
"version": "3.0.0", | ||
"structure": [ | ||
"Q", | ||
"C", | ||
"M", | ||
"I", | ||
"O", | ||
"J", | ||
"B", | ||
"D", | ||
"K", | ||
"H", | ||
"R" | ||
], | ||
"adapters": { | ||
"Q": "AAGCACCATAATGTGT", | ||
"C": "ACTCTGTCAGGTCCGA", | ||
"M": "ACCTAGATCAGAGCCT", | ||
"I": "AGTGCGTTGCGAATTG", | ||
"O": "AAGTCACCGGCACCTT", | ||
"J": "AATTGCGTAGTTGGCC", | ||
"B": "ACTTGTAAGCTGTCTA", | ||
"D": "ACCTCCTCCTCCAGAA", | ||
"K": "ACACTTGGTCGCAATC", | ||
"H": "ATGTTGAATCCTAGCG", | ||
"R": "AACCGGACACACTTAG" | ||
}, | ||
"deprecated": false, | ||
"name": "mas_10" | ||
} | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,44 @@ | ||
{ | ||
"array": { | ||
"description": "15-element MAS-ISO-seq array", | ||
"version": "3.0.0", | ||
"structure": [ | ||
"A", | ||
"B", | ||
"C", | ||
"D", | ||
"E", | ||
"F", | ||
"G", | ||
"H", | ||
"I", | ||
"J", | ||
"K", | ||
"L", | ||
"M", | ||
"N", | ||
"O", | ||
"P" | ||
], | ||
"adapters": { | ||
"A": "AGCTTACTTGTGAAGA", | ||
"B": "ACTTGTAAGCTGTCTA", | ||
"C": "ACTCTGTCAGGTCCGA", | ||
"D": "ACCTCCTCCTCCAGAA", | ||
"E": "AACCGGACACACTTAG", | ||
"F": "AGAGTCCAATTCGCAG", | ||
"G": "AATCAAGGCTTAACGG", | ||
"H": "ATGTTGAATCCTAGCG", | ||
"I": "AGTGCGTTGCGAATTG", | ||
"J": "AATTGCGTAGTTGGCC", | ||
"K": "ACACTTGGTCGCAATC", | ||
"L": "AGTAAGCCTTCGTGTC", | ||
"M": "ACCTAGATCAGAGCCT", | ||
"N": "AGGTATGCCGGTTAAG", | ||
"O": "AAGTCACCGGCACCTT", | ||
"P": "ATGAAGTGGCTCGAGA" | ||
}, | ||
"deprecated": false, | ||
"name": "mas_15" | ||
} | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,46 @@ | ||
{ | ||
"array": { | ||
"description": "16-element MAS-ISO-seq array", | ||
"version": "3.0.0", | ||
"structure": [ | ||
"A", | ||
"B", | ||
"C", | ||
"D", | ||
"E", | ||
"F", | ||
"G", | ||
"H", | ||
"I", | ||
"J", | ||
"K", | ||
"L", | ||
"M", | ||
"N", | ||
"O", | ||
"P", | ||
"Q" | ||
], | ||
"adapters": { | ||
"A": "AGCTTACTTGTGAAGA", | ||
"B": "ACTTGTAAGCTGTCTA", | ||
"C": "ACTCTGTCAGGTCCGA", | ||
"D": "ACCTCCTCCTCCAGAA", | ||
"E": "AACCGGACACACTTAG", | ||
"F": "AGAGTCCAATTCGCAG", | ||
"G": "AATCAAGGCTTAACGG", | ||
"H": "ATGTTGAATCCTAGCG", | ||
"I": "AGTGCGTTGCGAATTG", | ||
"J": "AATTGCGTAGTTGGCC", | ||
"K": "ACACTTGGTCGCAATC", | ||
"L": "AGTAAGCCTTCGTGTC", | ||
"M": "ACCTAGATCAGAGCCT", | ||
"N": "AGGTATGCCGGTTAAG", | ||
"O": "AAGTCACCGGCACCTT", | ||
"P": "ATGAAGTGGCTCGAGA", | ||
"Q": "AGTAGCTGTGTGCA" | ||
}, | ||
"deprecated": false, | ||
"name": "mas_16" | ||
} | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,61 @@ | ||
{ | ||
"cdna": { | ||
"description": "single-cell 10x 3' kit", | ||
"version": "3.0.0", | ||
"structure": [ | ||
"5p_Adapter", | ||
"CBC", | ||
"UMI", | ||
"Poly_T", | ||
"cDNA", | ||
"3p_Adapter" | ||
], | ||
"adapters": { | ||
"5p_Adapter": "TCTACACGACGCTCTTCCGATCT", | ||
"CBC": { | ||
"FixedLengthRandomBases": 16 | ||
}, | ||
"UMI": { | ||
"FixedLengthRandomBases": 12 | ||
}, | ||
"Poly_T": { | ||
"HomopolymerRepeat": [ | ||
"T", | ||
30 | ||
] | ||
}, | ||
"cDNA": "random", | ||
"3p_Adapter": "CCCATGTACTCTGCGTTGATACCACTGCTT" | ||
}, | ||
"named_random_segments": [ | ||
"CBC", | ||
"UMI", | ||
"cDNA" | ||
], | ||
"coding_region": "cDNA", | ||
"annotation_segments": { | ||
"UMI": [ | ||
[ | ||
"ZU", | ||
"XU" | ||
], | ||
[ | ||
"XM", | ||
"XU" | ||
] | ||
], | ||
"CBC": [ | ||
[ | ||
"CR", | ||
"XB" | ||
], | ||
[ | ||
"XC", | ||
"XB" | ||
] | ||
] | ||
}, | ||
"deprecated": false, | ||
"name": "sc_10x3p" | ||
} | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,63 @@ | ||
{ | ||
"cdna": { | ||
"description": "single-cell 10x 5' kit", | ||
"version": "3.0.0", | ||
"structure": [ | ||
"5p_Adapter", | ||
"CBC", | ||
"UMI", | ||
"SLS", | ||
"cDNA", | ||
"Poly_A", | ||
"3p_Adapter" | ||
], | ||
"adapters": { | ||
"5p_Adapter": "TCTACACGACGCTCTTCCGATCT", | ||
"CBC": { | ||
"FixedLengthRandomBases": 16 | ||
}, | ||
"UMI": { | ||
"FixedLengthRandomBases": 10 | ||
}, | ||
"SLS": "TTTCTTATATGGG", | ||
"cDNA": "random", | ||
"Poly_A": { | ||
"HomopolymerRepeat": [ | ||
"A", | ||
30 | ||
] | ||
}, | ||
"3p_Adapter": "GTACTCTGCGTTGATACCACTGCTT" | ||
}, | ||
"named_random_segments": [ | ||
"CBC", | ||
"UMI", | ||
"cDNA" | ||
], | ||
"coding_region": "cDNA", | ||
"annotation_segments": { | ||
"UMI": [ | ||
[ | ||
"ZU", | ||
"XU" | ||
], | ||
[ | ||
"XM", | ||
"XU" | ||
] | ||
], | ||
"CBC": [ | ||
[ | ||
"CR", | ||
"XB" | ||
], | ||
[ | ||
"XC", | ||
"XB" | ||
] | ||
] | ||
}, | ||
"deprecated": false, | ||
"name": "sc_10x5p" | ||
} | ||
} |
Oops, something went wrong.